ID: 905236920

View in Genome Browser
Species Human (GRCh38)
Location 1:36556321-36556343
Sequence TCTGGGCAACCCTACTGAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905236920_905236926 26 Left 905236920 1:36556321-36556343 CCACTTCAGTAGGGTTGCCCAGA No data
Right 905236926 1:36556370-36556392 AACTTACCGTGTGCTAGGCATGG No data
905236920_905236924 21 Left 905236920 1:36556321-36556343 CCACTTCAGTAGGGTTGCCCAGA No data
Right 905236924 1:36556365-36556387 CACCTAACTTACCGTGTGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905236920 Original CRISPR TCTGGGCAACCCTACTGAAG TGG (reversed) Intergenic