ID: 905236924

View in Genome Browser
Species Human (GRCh38)
Location 1:36556365-36556387
Sequence CACCTAACTTACCGTGTGCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905236920_905236924 21 Left 905236920 1:36556321-36556343 CCACTTCAGTAGGGTTGCCCAGA No data
Right 905236924 1:36556365-36556387 CACCTAACTTACCGTGTGCTAGG No data
905236922_905236924 3 Left 905236922 1:36556339-36556361 CCAGAGTGAGATAACATCACCAG No data
Right 905236924 1:36556365-36556387 CACCTAACTTACCGTGTGCTAGG No data
905236921_905236924 4 Left 905236921 1:36556338-36556360 CCCAGAGTGAGATAACATCACCA No data
Right 905236924 1:36556365-36556387 CACCTAACTTACCGTGTGCTAGG No data
905236919_905236924 29 Left 905236919 1:36556313-36556335 CCTCTTTACCACTTCAGTAGGGT No data
Right 905236924 1:36556365-36556387 CACCTAACTTACCGTGTGCTAGG No data
905236917_905236924 30 Left 905236917 1:36556312-36556334 CCCTCTTTACCACTTCAGTAGGG No data
Right 905236924 1:36556365-36556387 CACCTAACTTACCGTGTGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905236924 Original CRISPR CACCTAACTTACCGTGTGCT AGG Intergenic
No off target data available for this crispr