ID: 905236926

View in Genome Browser
Species Human (GRCh38)
Location 1:36556370-36556392
Sequence AACTTACCGTGTGCTAGGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905236920_905236926 26 Left 905236920 1:36556321-36556343 CCACTTCAGTAGGGTTGCCCAGA No data
Right 905236926 1:36556370-36556392 AACTTACCGTGTGCTAGGCATGG No data
905236921_905236926 9 Left 905236921 1:36556338-36556360 CCCAGAGTGAGATAACATCACCA No data
Right 905236926 1:36556370-36556392 AACTTACCGTGTGCTAGGCATGG No data
905236922_905236926 8 Left 905236922 1:36556339-36556361 CCAGAGTGAGATAACATCACCAG No data
Right 905236926 1:36556370-36556392 AACTTACCGTGTGCTAGGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905236926 Original CRISPR AACTTACCGTGTGCTAGGCA TGG Intergenic
No off target data available for this crispr