ID: 905238648

View in Genome Browser
Species Human (GRCh38)
Location 1:36567922-36567944
Sequence ATCCAGATGGGGCTTAGAAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905238648_905238660 19 Left 905238648 1:36567922-36567944 CCCATTCTAAGCCCCATCTGGAT No data
Right 905238660 1:36567964-36567986 CTTCCCATCCCAGACCTTGGTGG No data
905238648_905238662 21 Left 905238648 1:36567922-36567944 CCCATTCTAAGCCCCATCTGGAT No data
Right 905238662 1:36567966-36567988 TCCCATCCCAGACCTTGGTGGGG No data
905238648_905238657 16 Left 905238648 1:36567922-36567944 CCCATTCTAAGCCCCATCTGGAT No data
Right 905238657 1:36567961-36567983 ACCCTTCCCATCCCAGACCTTGG No data
905238648_905238661 20 Left 905238648 1:36567922-36567944 CCCATTCTAAGCCCCATCTGGAT No data
Right 905238661 1:36567965-36567987 TTCCCATCCCAGACCTTGGTGGG No data
905238648_905238664 22 Left 905238648 1:36567922-36567944 CCCATTCTAAGCCCCATCTGGAT No data
Right 905238664 1:36567967-36567989 CCCATCCCAGACCTTGGTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905238648 Original CRISPR ATCCAGATGGGGCTTAGAAT GGG (reversed) Intergenic
No off target data available for this crispr