ID: 905240858

View in Genome Browser
Species Human (GRCh38)
Location 1:36580667-36580689
Sequence ATTGGGAAGGACAATGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905240853_905240858 -6 Left 905240853 1:36580650-36580672 CCTTGGCACGCTGGGGGATTGGG No data
Right 905240858 1:36580667-36580689 ATTGGGAAGGACAATGAGGAGGG No data
905240845_905240858 13 Left 905240845 1:36580631-36580653 CCCTTTGGTGTTTTTCTCACCTT No data
Right 905240858 1:36580667-36580689 ATTGGGAAGGACAATGAGGAGGG No data
905240846_905240858 12 Left 905240846 1:36580632-36580654 CCTTTGGTGTTTTTCTCACCTTG No data
Right 905240858 1:36580667-36580689 ATTGGGAAGGACAATGAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905240858 Original CRISPR ATTGGGAAGGACAATGAGGA GGG Intergenic
No off target data available for this crispr