ID: 905245686

View in Genome Browser
Species Human (GRCh38)
Location 1:36611832-36611854
Sequence GTTATCTGTGGTCCCCAATC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905245676_905245686 28 Left 905245676 1:36611781-36611803 CCATTAACAGGATCACCTGCCTG No data
Right 905245686 1:36611832-36611854 GTTATCTGTGGTCCCCAATCTGG No data
905245682_905245686 9 Left 905245682 1:36611800-36611822 CCTGGGAGGGCATGAGTGACTGT No data
Right 905245686 1:36611832-36611854 GTTATCTGTGGTCCCCAATCTGG No data
905245681_905245686 13 Left 905245681 1:36611796-36611818 CCTGCCTGGGAGGGCATGAGTGA No data
Right 905245686 1:36611832-36611854 GTTATCTGTGGTCCCCAATCTGG No data
905245675_905245686 29 Left 905245675 1:36611780-36611802 CCCATTAACAGGATCACCTGCCT No data
Right 905245686 1:36611832-36611854 GTTATCTGTGGTCCCCAATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905245686 Original CRISPR GTTATCTGTGGTCCCCAATC TGG Intergenic
No off target data available for this crispr