ID: 905245736

View in Genome Browser
Species Human (GRCh38)
Location 1:36612052-36612074
Sequence TCCACAGCTTAGAGAAGCCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905245736_905245747 22 Left 905245736 1:36612052-36612074 CCAAGGCTTCTCTAAGCTGTGGA No data
Right 905245747 1:36612097-36612119 TAAGGGTGCTCTTGGGGATGGGG No data
905245736_905245744 16 Left 905245736 1:36612052-36612074 CCAAGGCTTCTCTAAGCTGTGGA No data
Right 905245744 1:36612091-36612113 AGGAACTAAGGGTGCTCTTGGGG No data
905245736_905245741 5 Left 905245736 1:36612052-36612074 CCAAGGCTTCTCTAAGCTGTGGA No data
Right 905245741 1:36612080-36612102 CGAGTCTAATGAGGAACTAAGGG No data
905245736_905245745 20 Left 905245736 1:36612052-36612074 CCAAGGCTTCTCTAAGCTGTGGA No data
Right 905245745 1:36612095-36612117 ACTAAGGGTGCTCTTGGGGATGG No data
905245736_905245746 21 Left 905245736 1:36612052-36612074 CCAAGGCTTCTCTAAGCTGTGGA No data
Right 905245746 1:36612096-36612118 CTAAGGGTGCTCTTGGGGATGGG No data
905245736_905245739 -4 Left 905245736 1:36612052-36612074 CCAAGGCTTCTCTAAGCTGTGGA No data
Right 905245739 1:36612071-36612093 TGGAGGGTACGAGTCTAATGAGG No data
905245736_905245740 4 Left 905245736 1:36612052-36612074 CCAAGGCTTCTCTAAGCTGTGGA No data
Right 905245740 1:36612079-36612101 ACGAGTCTAATGAGGAACTAAGG No data
905245736_905245742 14 Left 905245736 1:36612052-36612074 CCAAGGCTTCTCTAAGCTGTGGA No data
Right 905245742 1:36612089-36612111 TGAGGAACTAAGGGTGCTCTTGG No data
905245736_905245743 15 Left 905245736 1:36612052-36612074 CCAAGGCTTCTCTAAGCTGTGGA No data
Right 905245743 1:36612090-36612112 GAGGAACTAAGGGTGCTCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905245736 Original CRISPR TCCACAGCTTAGAGAAGCCT TGG (reversed) Intergenic