ID: 905245746

View in Genome Browser
Species Human (GRCh38)
Location 1:36612096-36612118
Sequence CTAAGGGTGCTCTTGGGGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905245736_905245746 21 Left 905245736 1:36612052-36612074 CCAAGGCTTCTCTAAGCTGTGGA No data
Right 905245746 1:36612096-36612118 CTAAGGGTGCTCTTGGGGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905245746 Original CRISPR CTAAGGGTGCTCTTGGGGAT GGG Intergenic
No off target data available for this crispr