ID: 905246763

View in Genome Browser
Species Human (GRCh38)
Location 1:36620325-36620347
Sequence CCGAGTCAGCACTTCTTTCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905246763_905246765 12 Left 905246763 1:36620325-36620347 CCTTGAAAGAAGTGCTGACTCGG No data
Right 905246765 1:36620360-36620382 GCTGTGTCCTCCTTACTAGTAGG No data
905246763_905246767 17 Left 905246763 1:36620325-36620347 CCTTGAAAGAAGTGCTGACTCGG No data
Right 905246767 1:36620365-36620387 GTCCTCCTTACTAGTAGGCAGGG No data
905246763_905246766 16 Left 905246763 1:36620325-36620347 CCTTGAAAGAAGTGCTGACTCGG No data
Right 905246766 1:36620364-36620386 TGTCCTCCTTACTAGTAGGCAGG No data
905246763_905246770 30 Left 905246763 1:36620325-36620347 CCTTGAAAGAAGTGCTGACTCGG No data
Right 905246770 1:36620378-36620400 GTAGGCAGGGTTCCTGTAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905246763 Original CRISPR CCGAGTCAGCACTTCTTTCA AGG (reversed) Intergenic
No off target data available for this crispr