ID: 905248386

View in Genome Browser
Species Human (GRCh38)
Location 1:36630308-36630330
Sequence GAAACAATGTTGGCTGGTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905248386_905248392 21 Left 905248386 1:36630308-36630330 CCTGGACCAGCCAACATTGTTTC No data
Right 905248392 1:36630352-36630374 TTAGAATTATTTCACCCATGTGG 0: 1
1: 0
2: 1
3: 21
4: 238
905248386_905248393 24 Left 905248386 1:36630308-36630330 CCTGGACCAGCCAACATTGTTTC No data
Right 905248393 1:36630355-36630377 GAATTATTTCACCCATGTGGAGG 0: 1
1: 0
2: 0
3: 13
4: 157

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905248386 Original CRISPR GAAACAATGTTGGCTGGTCC AGG (reversed) Intergenic
No off target data available for this crispr