ID: 905254563

View in Genome Browser
Species Human (GRCh38)
Location 1:36671863-36671885
Sequence GGTTGTCTGCAGAGCATGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905254563_905254564 -4 Left 905254563 1:36671863-36671885 CCAGTCATGCTCTGCAGACAACC No data
Right 905254564 1:36671882-36671904 AACCTCAACTTGCCCTCTACTGG No data
905254563_905254565 -3 Left 905254563 1:36671863-36671885 CCAGTCATGCTCTGCAGACAACC No data
Right 905254565 1:36671883-36671905 ACCTCAACTTGCCCTCTACTGGG No data
905254563_905254569 20 Left 905254563 1:36671863-36671885 CCAGTCATGCTCTGCAGACAACC No data
Right 905254569 1:36671906-36671928 TAGATCAAAGTCATCAGATGTGG No data
905254563_905254570 21 Left 905254563 1:36671863-36671885 CCAGTCATGCTCTGCAGACAACC No data
Right 905254570 1:36671907-36671929 AGATCAAAGTCATCAGATGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905254563 Original CRISPR GGTTGTCTGCAGAGCATGAC TGG (reversed) Intergenic
No off target data available for this crispr