ID: 905256062

View in Genome Browser
Species Human (GRCh38)
Location 1:36685849-36685871
Sequence CTGATTGACATCAGGGAAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905256059_905256062 2 Left 905256059 1:36685824-36685846 CCTTTTGATTAGTTTGCAAGAAT No data
Right 905256062 1:36685849-36685871 CTGATTGACATCAGGGAAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905256062 Original CRISPR CTGATTGACATCAGGGAAGA TGG Intergenic
No off target data available for this crispr