ID: 905257142

View in Genome Browser
Species Human (GRCh38)
Location 1:36692155-36692177
Sequence GAGAACAATATGGAGGTGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905257142_905257159 16 Left 905257142 1:36692155-36692177 CCCCTCACCTCCATATTGTTCTC No data
Right 905257159 1:36692194-36692216 GGAAAACAGTACCAAGAATGGGG No data
905257142_905257151 -5 Left 905257142 1:36692155-36692177 CCCCTCACCTCCATATTGTTCTC No data
Right 905257151 1:36692173-36692195 TTCTCTGCCCCGGGGTCCCAGGG No data
905257142_905257157 14 Left 905257142 1:36692155-36692177 CCCCTCACCTCCATATTGTTCTC No data
Right 905257157 1:36692192-36692214 AGGGAAAACAGTACCAAGAATGG No data
905257142_905257150 -6 Left 905257142 1:36692155-36692177 CCCCTCACCTCCATATTGTTCTC No data
Right 905257150 1:36692172-36692194 GTTCTCTGCCCCGGGGTCCCAGG No data
905257142_905257158 15 Left 905257142 1:36692155-36692177 CCCCTCACCTCCATATTGTTCTC No data
Right 905257158 1:36692193-36692215 GGGAAAACAGTACCAAGAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905257142 Original CRISPR GAGAACAATATGGAGGTGAG GGG (reversed) Intergenic
No off target data available for this crispr