ID: 905259317

View in Genome Browser
Species Human (GRCh38)
Location 1:36706360-36706382
Sequence ACTTCTTCCCAGGAGATGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905259313_905259317 8 Left 905259313 1:36706329-36706351 CCATGGAAGCTGGAAGGGCTTCT No data
Right 905259317 1:36706360-36706382 ACTTCTTCCCAGGAGATGGCAGG No data
905259311_905259317 13 Left 905259311 1:36706324-36706346 CCAGACCATGGAAGCTGGAAGGG No data
Right 905259317 1:36706360-36706382 ACTTCTTCCCAGGAGATGGCAGG No data
905259308_905259317 22 Left 905259308 1:36706315-36706337 CCAGGTAAGCCAGACCATGGAAG No data
Right 905259317 1:36706360-36706382 ACTTCTTCCCAGGAGATGGCAGG No data
905259306_905259317 28 Left 905259306 1:36706309-36706331 CCTGTGCCAGGTAAGCCAGACCA No data
Right 905259317 1:36706360-36706382 ACTTCTTCCCAGGAGATGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905259317 Original CRISPR ACTTCTTCCCAGGAGATGGC AGG Intergenic
No off target data available for this crispr