ID: 905260235

View in Genome Browser
Species Human (GRCh38)
Location 1:36712130-36712152
Sequence AAGGAGAAGAAAGAGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905260235_905260246 18 Left 905260235 1:36712130-36712152 CCTTCCTCCTCTTTCTTCTCCTT No data
Right 905260246 1:36712171-36712193 TTCTTAGGGACACAGTTTTAGGG No data
905260235_905260242 4 Left 905260235 1:36712130-36712152 CCTTCCTCCTCTTTCTTCTCCTT No data
Right 905260242 1:36712157-36712179 TCCTCCTTCTGTGATTCTTAGGG No data
905260235_905260245 17 Left 905260235 1:36712130-36712152 CCTTCCTCCTCTTTCTTCTCCTT No data
Right 905260245 1:36712170-36712192 ATTCTTAGGGACACAGTTTTAGG No data
905260235_905260241 3 Left 905260235 1:36712130-36712152 CCTTCCTCCTCTTTCTTCTCCTT No data
Right 905260241 1:36712156-36712178 TTCCTCCTTCTGTGATTCTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905260235 Original CRISPR AAGGAGAAGAAAGAGGAGGA AGG (reversed) Intergenic
No off target data available for this crispr