ID: 905269752

View in Genome Browser
Species Human (GRCh38)
Location 1:36779826-36779848
Sequence GAGGGTAAAGAGTGGGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 5588
Summary {0: 6, 1: 46, 2: 436, 3: 1553, 4: 3547}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905269752 Original CRISPR GAGGGTAAAGAGTGGGAGGA GGG (reversed) Intergenic
Too many off-targets to display for this crispr