ID: 905271393

View in Genome Browser
Species Human (GRCh38)
Location 1:36790018-36790040
Sequence ACAGGATATAAGGGAAAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905271393_905271401 4 Left 905271393 1:36790018-36790040 CCATCTTTTCCCTTATATCCTGT No data
Right 905271401 1:36790045-36790067 TACGGGTAACTTAGTCTTCAAGG No data
905271393_905271404 12 Left 905271393 1:36790018-36790040 CCATCTTTTCCCTTATATCCTGT No data
Right 905271404 1:36790053-36790075 ACTTAGTCTTCAAGGGGCTCTGG No data
905271393_905271406 20 Left 905271393 1:36790018-36790040 CCATCTTTTCCCTTATATCCTGT No data
Right 905271406 1:36790061-36790083 TTCAAGGGGCTCTGGCTATTGGG No data
905271393_905271405 19 Left 905271393 1:36790018-36790040 CCATCTTTTCCCTTATATCCTGT No data
Right 905271405 1:36790060-36790082 CTTCAAGGGGCTCTGGCTATTGG No data
905271393_905271402 5 Left 905271393 1:36790018-36790040 CCATCTTTTCCCTTATATCCTGT No data
Right 905271402 1:36790046-36790068 ACGGGTAACTTAGTCTTCAAGGG No data
905271393_905271409 29 Left 905271393 1:36790018-36790040 CCATCTTTTCCCTTATATCCTGT No data
Right 905271409 1:36790070-36790092 CTCTGGCTATTGGGGAATCAGGG No data
905271393_905271407 21 Left 905271393 1:36790018-36790040 CCATCTTTTCCCTTATATCCTGT No data
Right 905271407 1:36790062-36790084 TCAAGGGGCTCTGGCTATTGGGG No data
905271393_905271403 6 Left 905271393 1:36790018-36790040 CCATCTTTTCCCTTATATCCTGT No data
Right 905271403 1:36790047-36790069 CGGGTAACTTAGTCTTCAAGGGG No data
905271393_905271408 28 Left 905271393 1:36790018-36790040 CCATCTTTTCCCTTATATCCTGT No data
Right 905271408 1:36790069-36790091 GCTCTGGCTATTGGGGAATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905271393 Original CRISPR ACAGGATATAAGGGAAAAGA TGG (reversed) Intergenic
No off target data available for this crispr