ID: 905272227

View in Genome Browser
Species Human (GRCh38)
Location 1:36794592-36794614
Sequence CTTTCCATGTGGCAGGTGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 278
Summary {0: 1, 1: 0, 2: 3, 3: 30, 4: 244}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905272227_905272233 27 Left 905272227 1:36794592-36794614 CCTACCACCTGCCACATGGAAAG 0: 1
1: 0
2: 3
3: 30
4: 244
Right 905272233 1:36794642-36794664 GATGATGTCATAGGAGAACATGG 0: 1
1: 0
2: 2
3: 19
4: 330
905272227_905272232 18 Left 905272227 1:36794592-36794614 CCTACCACCTGCCACATGGAAAG 0: 1
1: 0
2: 3
3: 30
4: 244
Right 905272232 1:36794633-36794655 TATTTTTAAGATGATGTCATAGG 0: 1
1: 0
2: 2
3: 52
4: 555

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905272227 Original CRISPR CTTTCCATGTGGCAGGTGGT AGG (reversed) Intergenic
902114336 1:14108525-14108547 CCTCCCAGGAGGCAGGTGGTGGG + Intergenic
902401042 1:16156898-16156920 CTTATCAAGGGGCAGGTGGTAGG - Intergenic
904788219 1:32998401-32998423 AGCTCCATGTGGCAGATGGTGGG - Intergenic
905272227 1:36794592-36794614 CTTTCCATGTGGCAGGTGGTAGG - Intergenic
906007317 1:42487019-42487041 CCTTCCAAGTGGCAAGTAGTTGG - Intronic
906638817 1:47428791-47428813 CTCTCCATGTGGCAGGGAGATGG + Intergenic
906896173 1:49774476-49774498 CTTTATATGGGGCAGGTGGAGGG + Intronic
907787549 1:57627290-57627312 CTTTGCAGGTGGCAGATCGTGGG + Intronic
908102913 1:60809770-60809792 CCTTTGATGTGGCAGGGGGTGGG + Intergenic
908599137 1:65719854-65719876 GTGTCCTTGTGGCAGGGGGTTGG + Intergenic
908769051 1:67579870-67579892 CTTACCATGTGGCAGGTGCTTGG - Intergenic
909564498 1:77039541-77039563 CTTTGTATGTGGCAGCAGGTAGG + Intronic
910037816 1:82809344-82809366 CTCTTCATGGGGCAGGTTGTAGG - Intergenic
910400844 1:86836544-86836566 CTTTCCTTCTGGCAGGCTGTTGG + Intergenic
912123971 1:106510048-106510070 GTGTCCATGTAGCAGGTGGGAGG + Intergenic
912687524 1:111778967-111778989 CTTTCCAAGTTGCATGTGCTGGG - Intronic
915492837 1:156260960-156260982 TTTTCCAGCTGGAAGGTGGTAGG + Intronic
916818675 1:168377286-168377308 CTTTCCATTTGGAAGATGATTGG + Intergenic
916884892 1:169057689-169057711 CTTCCCATGTGACAGGAGATGGG - Intergenic
920844880 1:209585404-209585426 CTTTCCTGGTGGCAGTTGCTGGG - Intronic
922248629 1:223825873-223825895 CTTGCCATCTGGTAGGTAGTTGG - Intronic
922352993 1:224750114-224750136 CTTTGTATGTGGTAGGTGGTAGG + Intergenic
922398713 1:225228545-225228567 CATTCCATGTGGCTGTTTGTTGG - Intronic
1062824251 10:556727-556749 TTTTCAATGTGGTAGGTGTTGGG - Intronic
1063184318 10:3636847-3636869 CTTTCCATCTGGCAGGGGTGTGG + Intergenic
1063497547 10:6524452-6524474 CGGTAGATGTGGCAGGTGGTAGG - Intronic
1063574935 10:7253081-7253103 ACTTCCATGTGCCAGGAGGTGGG + Intronic
1065923308 10:30412543-30412565 CTTTCCTAATGACAGGTGGTAGG - Intergenic
1066382445 10:34912909-34912931 CCTCACATGAGGCAGGTGGTCGG - Intergenic
1066792567 10:39081978-39082000 AATTCCATGTGGCAGATGGATGG - Intergenic
1067096116 10:43301423-43301445 CTTTCCATATGGCTGTTTGTTGG + Intergenic
1067232500 10:44421920-44421942 GTTTACATGTGGCAGGTGGGTGG - Intergenic
1069791420 10:71024676-71024698 CATCCCATGTGGAAGGTGGAAGG - Intergenic
1069912192 10:71766367-71766389 CTTACCTGGTGGCAGGTGGCGGG - Intronic
1070257083 10:74822169-74822191 GATTCCATGTGGCAGTTGGAAGG + Intergenic
1072690439 10:97569398-97569420 CTTCACATGTGCCAGGTGCTGGG - Intronic
1072739753 10:97902309-97902331 CCTTCCCTGAGGCAGGTGGTGGG - Intronic
1074718059 10:116238238-116238260 CTTTCAATGTGGCAGGCCCTGGG + Intronic
1074747194 10:116546638-116546660 CTTACCATGTGTCAGGTGCTGGG - Intronic
1074750124 10:116577844-116577866 CTTACCATGTGCCAGGTGCTAGG - Intergenic
1077236112 11:1482732-1482754 ATTCCCATGGGGCAGGTGGACGG + Intronic
1078190983 11:9092046-9092068 CTTTCCACGTGGGAGGTGGGAGG + Intronic
1078567139 11:12426021-12426043 CCTCCCATGTGCCAGGTGTTGGG + Intronic
1078919706 11:15818223-15818245 CTTTCTCTGTGCCAGGTGCTGGG - Intergenic
1078926799 11:15882355-15882377 TTTTGCATGTGCCAGGTGTTAGG - Intergenic
1081440229 11:43072631-43072653 GTTTCCATGTGGCTTGTGGAAGG + Intergenic
1083190398 11:61047881-61047903 CTGTTCATGTTGTAGGTGGTGGG - Intergenic
1083869838 11:65479921-65479943 CTCTCCCTGTGGAAGGTGGGGGG + Intergenic
1083955928 11:65982719-65982741 CTGTCCACGTGGCTGCTGGTGGG - Intergenic
1085927572 11:81039671-81039693 CCTTCCATGTGGCTGTTTGTTGG - Intergenic
1086216231 11:84384936-84384958 GTTTCCATGTGCCAGGTGCAGGG + Intronic
1087138648 11:94744396-94744418 CTATCCATGTGCCAGGAGGGTGG - Intronic
1087587522 11:100141113-100141135 ATTTCCATAGGGCACGTGGTTGG + Intronic
1088357552 11:108959731-108959753 CTTTCTATGTGGCAGGCACTGGG - Intergenic
1088357755 11:108961095-108961117 CCTTCCATGTGGCAGGGAGGTGG - Intergenic
1088589903 11:111394521-111394543 AGTTCCATGTGGCTGGTGGGGGG - Intronic
1088965289 11:114714638-114714660 CTTTACATGTGGCAGCTGAAAGG + Intergenic
1090310040 11:125728376-125728398 CTTTACATATGGCAGGTGCTGGG - Intergenic
1091028854 11:132165520-132165542 CTTTCCATGTGACAGGTACTAGG + Intronic
1091951854 12:4599525-4599547 CTTTCCATTTGACTTGTGGTCGG - Intronic
1095377183 12:41544139-41544161 CATTGCATGTAGCAGGTGCTAGG + Intronic
1095849949 12:46791682-46791704 CAGACAATGTGGCAGGTGGTGGG + Intronic
1096236686 12:49933152-49933174 CTTTCTATGTGTCATGTGTTAGG - Intergenic
1097300164 12:58009560-58009582 CTTTCCATGTGGCTGGCAGAAGG + Intergenic
1097694971 12:62767059-62767081 CTTACCATGAGGCATGTGGCAGG - Intronic
1100153551 12:91770734-91770756 CATGCCATGTTGCAGGTGGATGG + Intergenic
1100602681 12:96125654-96125676 GTTTGAATGTGGCAGGTGGGGGG - Intergenic
1100713004 12:97277215-97277237 ACTTCCCTGTGGCAGGTGGGTGG + Intergenic
1101054430 12:100897518-100897540 CTTTCCATAGGGCAGGTGTGGGG - Intronic
1101719155 12:107336005-107336027 CTTTGCATTGGGCGGGTGGTGGG - Intronic
1101982437 12:109419276-109419298 TTTTCCATGTGCCGGGTGCTAGG + Intronic
1102077398 12:110070629-110070651 AATTCCATGTAGCAGGTGATGGG - Intronic
1102185052 12:110941339-110941361 CTTCCCATGTGGCAGGCGCTCGG + Intergenic
1103135816 12:118506733-118506755 CATTCCACTTGGCAGGAGGTTGG - Intergenic
1104212155 12:126699203-126699225 CATTCCAGGTAGCAGCTGGTAGG + Intergenic
1104219025 12:126763986-126764008 CTTGCCTTGTGGAAGGTGTTTGG + Intergenic
1104736946 12:131140843-131140865 GTCACCATGTGGCAGGTGGCTGG - Exonic
1105013977 12:132774761-132774783 TTTTCCAGGAGGCAGGTGGGAGG - Intronic
1105844462 13:24282200-24282222 CTGGCCATGTGCCAGGTGCTCGG - Intronic
1108691712 13:52865036-52865058 TTGTCCATGTGACAGGTGCTGGG + Intergenic
1109319246 13:60789726-60789748 CTTTTTATATGACAGGTGGTTGG + Intergenic
1109848175 13:68024683-68024705 CATTCCTGGTGGCAGGTGTTTGG + Intergenic
1110492809 13:76128774-76128796 CTTTGCATAGGGTAGGTGGTAGG + Intergenic
1112329484 13:98465967-98465989 CTTTCCAGGTGGCATGTGTTAGG - Intronic
1112589588 13:100751156-100751178 CTTTCCATGTGTGAGGGGTTGGG - Intergenic
1112792178 13:103015353-103015375 CCTTGCAGGTGGCAGATGGTGGG - Intergenic
1113661565 13:112109718-112109740 CTTTCAATGGGGCAGGTTGGGGG + Intergenic
1115562667 14:34597158-34597180 GTTACCATGGGGCAGGTGGGTGG - Intronic
1117164129 14:53017066-53017088 CTTGCCTTGTGTCAGGTGGCTGG + Intergenic
1117588771 14:57242687-57242709 CTTTCCATTGGGAAGGTGATTGG + Intronic
1118014679 14:61647617-61647639 CTTTCCCTGTGTCAGGCCGTAGG + Intronic
1119904298 14:78287429-78287451 CCTACAATGTGGCAGGTAGTGGG - Intronic
1120030928 14:79639886-79639908 CTTTCCTTGGGGCTGATGGTGGG - Intronic
1121517619 14:94563300-94563322 CCATACATGTGGAAGGTGGTGGG + Intronic
1124594000 15:31078725-31078747 CTTTCCAGGCAGCAGGTGCTGGG - Intronic
1126049444 15:44673147-44673169 GTTTCCCTGTGGCAACTGGTAGG + Intronic
1127841920 15:62839212-62839234 CTTTCCATGTGGCAGGAAGAGGG + Intronic
1127885893 15:63200724-63200746 ATTTCCATTTGACAGATGGTGGG + Intronic
1128243447 15:66117128-66117150 CCTGGCATGTGGCAGGTGCTGGG + Intronic
1129183623 15:73892357-73892379 CTTGCCATGTTGCAGGTGACAGG + Intergenic
1130065829 15:80604371-80604393 CTGTTCATGGAGCAGGTGGTGGG - Intergenic
1130838553 15:87675434-87675456 TTTTCCATGTGGCATCTGCTGGG + Intergenic
1131893308 15:96997971-96997993 CATTCCTTTTGGCAGGAGGTGGG + Intergenic
1132258321 15:100398110-100398132 CTTTTTTTGTGGCGGGTGGTGGG + Intergenic
1132550878 16:553392-553414 CTTGCGATGTGCCAGGCGGTGGG - Exonic
1133584642 16:7181139-7181161 CTTGTCATGTGCCAGGTGGACGG + Intronic
1133709052 16:8383512-8383534 CTTTCCATGTGCCAGATAGTGGG - Intergenic
1134286680 16:12868003-12868025 CTTTCCCTATGGGAGGTGGGAGG - Intergenic
1134819269 16:17233051-17233073 CTTTGTATGTGGCAGGTGAAGGG - Intronic
1135058322 16:19249643-19249665 CTTTTCATGTGGAAGGTGGAAGG + Intronic
1135466591 16:22691649-22691671 GTTTCCATGTAGCAGTTGGCTGG - Intergenic
1135543751 16:23352063-23352085 CTTACCATGTGCCAGGTGCTAGG - Intronic
1135636860 16:24085048-24085070 TTTTCCATATGGGAAGTGGTAGG + Intronic
1137066927 16:35856489-35856511 CTTTCCATATGGCTGTTTGTTGG - Intergenic
1137314084 16:47298868-47298890 CTTTCAGTGTCCCAGGTGGTGGG + Intronic
1137335515 16:47545196-47545218 CTTTCCATCTGGCATGTTTTTGG + Intronic
1137708630 16:50551441-50551463 CATGACATGTGTCAGGTGGTTGG + Intronic
1139430393 16:66908028-66908050 CTTTCTATGTGGCAGGAGATGGG + Intergenic
1141290768 16:82716302-82716324 TTTTCCATGGGAAAGGTGGTGGG + Intronic
1141791937 16:86242944-86242966 CTGCCCATGTGGTAGGTGCTCGG - Intergenic
1142881572 17:2885968-2885990 GATTCCCTGTGGCAGGTGCTGGG + Intronic
1143305664 17:5944832-5944854 CTTTTGAAGTGACAGGTGGTTGG - Intronic
1144420725 17:15095606-15095628 AAATCCATGAGGCAGGTGGTAGG + Intergenic
1145396159 17:22496657-22496679 ATTGCCATGGGGCAGGGGGTTGG + Intergenic
1146939297 17:36833051-36833073 CTTTCCTTGTGGCAGGGAGGAGG + Intergenic
1148353650 17:46959195-46959217 CTGTCCATCTGTCTGGTGGTAGG - Intronic
1149638484 17:58188192-58188214 TCTTCCATGTGGAAGTTGGTTGG + Intergenic
1150008786 17:61486488-61486510 CTTTTCATGTGGCAGGTTTCTGG - Intergenic
1150220263 17:63492042-63492064 TTTCCCATGTGGCAGATGCTGGG + Intronic
1152026689 17:77814266-77814288 CTTGCCTTCTGGCAGGTGGCAGG - Intergenic
1152106010 17:78329564-78329586 GGTTCCATGTGGCAGGAAGTGGG + Intergenic
1155238708 18:23846093-23846115 CTCCTCCTGTGGCAGGTGGTAGG + Intronic
1155387754 18:25299024-25299046 ATTTCCACGTGGGAAGTGGTAGG - Intronic
1155393332 18:25360381-25360403 CTCACAATGTGGCAGGTGGTAGG - Intergenic
1156652213 18:39237897-39237919 CTTCCCATGTGGCTCATGGTGGG + Intergenic
1157292384 18:46419359-46419381 CTTTCAATGGGGGAGGAGGTGGG + Intronic
1159424901 18:68272411-68272433 TTTTCTATGTGGGAGGTGGGGGG + Intergenic
1161821147 19:6531839-6531861 CCCTCCATGTGGCAGTGGGTGGG + Intronic
1162754941 19:12852240-12852262 CTTTCCAGGTGCCGGCTGGTGGG + Exonic
1165446810 19:35861107-35861129 CCTTCCCTGTCGCAGGTGCTGGG + Exonic
1166534572 19:43564420-43564442 CTCACCATGTGCCAGGTGCTTGG + Intronic
1166872256 19:45877732-45877754 CCTGCCATATGGCAGGAGGTGGG + Intergenic
925918754 2:8625273-8625295 CCTTCCCTGTGGCAGGTGGTTGG + Intergenic
929591428 2:43149656-43149678 ATTTCCTGCTGGCAGGTGGTGGG - Intergenic
930188658 2:48435810-48435832 TGAGCCATGTGGCAGGTGGTTGG - Intergenic
930616662 2:53601056-53601078 GTTTCCATGAGTCAGGTGGCTGG - Intronic
931697609 2:64883274-64883296 CTTTCCATTTGACAGGTGACCGG + Intergenic
931807770 2:65824308-65824330 CTGTCCAGGTAGCAGGTGTTAGG - Intergenic
932537912 2:72619122-72619144 CTTTCCATGTGGTAGGAGAATGG - Intronic
932674163 2:73764056-73764078 CCTTCCATGTGTCAGATGCTGGG - Intronic
934556848 2:95291564-95291586 GTTTACATCTGGCAGGTGGCTGG + Intergenic
934669453 2:96200837-96200859 CTTTAAATGTTGCAGGGGGTAGG - Intronic
936899850 2:117470388-117470410 CTTTCCATGAGGCACATTGTTGG - Intergenic
937915141 2:127095259-127095281 CTTTCTTTGTGGGAGGTGGGAGG + Intronic
938924784 2:136029080-136029102 CTTTCCTTGTGTCAGGTCCTGGG + Intergenic
939622349 2:144435740-144435762 CTTTACATGTGGCAAGTGTCGGG + Intronic
940086999 2:149871371-149871393 CTTTTCATGTGGGCTGTGGTTGG - Intergenic
941901086 2:170678921-170678943 TTTCCCATCTGGCAGGTGGTTGG - Intergenic
945198206 2:207257013-207257035 CTGTGCATGTGGCAGGGGGAAGG + Intergenic
946136575 2:217652470-217652492 CTTTGCATATGGCAGGTTCTTGG - Intronic
947550407 2:231041521-231041543 CTTGCCATGTGCCAGGTGTGGGG + Intronic
949014762 2:241702701-241702723 GTTTCCAGGTGGCAGCAGGTCGG + Intronic
1169404298 20:5310610-5310632 CTGTACAGGTGGCAGGTGGTAGG - Intronic
1169911394 20:10650462-10650484 CTTTCCTTGTAGCAGGTGTCTGG - Intronic
1170481289 20:16767609-16767631 CTTTCCATGTGGTGGGTGGCAGG - Intronic
1172197416 20:33101500-33101522 CTTTCCGTGTGCCAGGTATTTGG + Intronic
1172442360 20:34974897-34974919 CTTTTCTAGTGGCAGGAGGTAGG + Intergenic
1173338766 20:42135637-42135659 CTCACCTTGTGCCAGGTGGTGGG + Intronic
1173539823 20:43842950-43842972 CTTTCCAAGGGCCAGGTGGCAGG - Intergenic
1173726099 20:45298967-45298989 CTTACCATGTGGTAGGTACTGGG + Intronic
1175805728 20:61828280-61828302 CTTCACAGGTGGCGGGTGGTGGG - Intronic
1175983585 20:62753396-62753418 CCTCCCTTGTGGCAGGAGGTTGG + Intronic
1176685604 21:9846075-9846097 CTTCCTATGTGGCATGTGCTAGG + Intergenic
1176953509 21:15073093-15073115 GGTTCCATGTGGCAGATGGTAGG - Intergenic
1179424036 21:41258915-41258937 CTTTCTCTGTGGCAGCAGGTGGG + Intronic
1180722637 22:17920747-17920769 ATTTCCATTTGGTGGGTGGTGGG - Intronic
1182326643 22:29518366-29518388 CTTACCATGTGGCAGGGGGATGG - Intronic
1182447079 22:30396103-30396125 CTTTCCATGTGCCAGGCAGTGGG + Intronic
1183107157 22:35622771-35622793 CTGTCCAGGTGACAGGTGGATGG - Intronic
950374545 3:12559971-12559993 CTTTTCAGCTGGCAGGTGGTAGG + Intronic
950870203 3:16221673-16221695 ATTTTCCTGTGGCAGGGGGTGGG - Intronic
952086054 3:29822836-29822858 CTTTTCTGGTGGAAGGTGGTAGG + Intronic
952668082 3:35932007-35932029 CTATGCATGGGGCAGGGGGTGGG - Intergenic
952683983 3:36129265-36129287 CTTGCCAAGCTGCAGGTGGTGGG + Intergenic
954069992 3:48135934-48135956 CTTGCCATGTGGCAGATGAAAGG - Intergenic
954421294 3:50420367-50420389 TTTTCCATGTGGGGAGTGGTGGG + Intronic
955209241 3:56925574-56925596 CTTGCTATGTGTCAGATGGTAGG + Intronic
955341880 3:58131228-58131250 CTCTGGATGTGGCAGATGGTGGG + Intronic
956665555 3:71638869-71638891 CCTTCCATATAGCAGGTGGCAGG - Intergenic
961372738 3:126441296-126441318 CTTTCTATGCTGAAGGTGGTGGG - Intronic
961449088 3:126994449-126994471 CTGCCCATGTGGCCTGTGGTGGG - Intronic
961577770 3:127852130-127852152 CTGGCCATATGGCAGGTGGAGGG - Intergenic
963500733 3:146122206-146122228 CTTCCTATGTGGCAGGTTGAGGG + Intronic
963809600 3:149762728-149762750 CCTTCCATGGGGTAGGAGGTAGG - Intronic
964356172 3:155853969-155853991 CTGTCCTTGTGGGAGATGGTGGG + Exonic
967474490 3:189900775-189900797 CTGTCTATGTGCCAGGTGGGTGG + Intergenic
968489134 4:880850-880872 CTTTCCCTGTGGCATGTGGCTGG - Intronic
971174801 4:24271831-24271853 CTTACCATGTTCCAGGTGCTAGG - Intergenic
974279356 4:59772012-59772034 CTTTCCATGCGTCTGGTGCTAGG - Intergenic
974394759 4:61320541-61320563 CTTTCCATGTTGCAGCTTGGAGG + Intronic
976304505 4:83546313-83546335 ATTTCAATTTGGCAGGTGATGGG + Intronic
978311528 4:107389121-107389143 CTTTCTATGGGGCAGGAGTTGGG - Intergenic
979283663 4:118896712-118896734 CTTTGCATGTGGCAGATTATTGG + Intronic
980349056 4:131664555-131664577 CTTCCTATGTGGCATGTGCTAGG + Intergenic
980790003 4:137608164-137608186 GGTTCCAGGTGGCTGGTGGTTGG + Intergenic
982449257 4:155532618-155532640 CTTTCCATTTGGAAAATGGTTGG - Intergenic
985359237 4:189155071-189155093 CTTTCTATGTGGCTGCTTGTAGG - Intergenic
985380411 4:189388958-189388980 CCTCACATGTGGCAGGTGGTGGG - Intergenic
985847745 5:2364799-2364821 CTCTCCATTGGGCAGGGGGTGGG + Intergenic
990685833 5:58300084-58300106 CCTTCTATGTGGAAGGGGGTTGG - Intergenic
991258155 5:64638003-64638025 CGCTCCGTGTGGCATGTGGTAGG + Intergenic
992407302 5:76472042-76472064 TGTTCCATGCGGCAGCTGGTGGG + Intronic
993717528 5:91290532-91290554 CTTACTATGTGCCAGGTCGTTGG + Intergenic
997761721 5:136455102-136455124 CTTTCTATGTGCCAGGCGCTAGG + Intergenic
998159587 5:139805935-139805957 CTCTCCCTGTGGCAGCTGGAGGG - Intronic
1002198526 5:177513979-177514001 CTATACATAGGGCAGGTGGTGGG - Intronic
1003494165 6:6649402-6649424 CCTTCCATGTGGCAGGCCCTGGG - Intronic
1003938535 6:11000790-11000812 CTTACCATGTAGCAGGTACTAGG - Intronic
1004040910 6:11974513-11974535 CTTTCTATTTGGGAGGTGTTCGG - Intergenic
1007234480 6:40380382-40380404 CTGTGCATCTGGGAGGTGGTAGG + Intergenic
1007422435 6:41727845-41727867 GCTTCCAAGTGGCAGGTGGGTGG + Intronic
1010203188 6:73300146-73300168 CCTTCCATGTAGCAGGTGTGTGG - Intronic
1013715074 6:112950429-112950451 ACTTACATGTGGGAGGTGGTAGG - Intergenic
1014861633 6:126474987-126475009 CATTACATGTGGCATGTGGAAGG + Intergenic
1015428963 6:133107362-133107384 CTTTCCATGTGGCAGGCTCAGGG - Intergenic
1015640126 6:135322861-135322883 CTGTGCATGAGGCAGGTGGCAGG + Intronic
1015842018 6:137487397-137487419 CTTCCGATGTGCCAGGTGCTAGG - Intergenic
1015941280 6:138454883-138454905 CTTTCCATGTGCCAAGTGCTTGG + Intronic
1017115666 6:150974272-150974294 CTTACCATGTGTCAGGTGCCAGG - Intronic
1017740321 6:157400592-157400614 TTTTCCAAGTTGCAGGTTGTGGG - Intronic
1018030036 6:159834359-159834381 CATTTCCTGTGGCAGGTGGAAGG + Intergenic
1020495653 7:8850005-8850027 CTCTCCATTTTTCAGGTGGTAGG - Intergenic
1020946412 7:14613871-14613893 CTTTCCAGTTCACAGGTGGTTGG - Intronic
1025236861 7:57240247-57240269 CCCTCCATGTGACAGGTGGCAGG - Intergenic
1028627400 7:92892883-92892905 GTTTCCTTTTGGCAGGTGGTGGG - Intergenic
1028889801 7:95974304-95974326 CTTACTATGTGCCAGGTGCTGGG - Intronic
1028990517 7:97044418-97044440 TTTCCCATGTGGAAGGTGGGGGG - Intergenic
1031156917 7:118121115-118121137 CTTTCCATATGGCTGTTTGTTGG - Intergenic
1031452637 7:121940789-121940811 TTTTTCATTTGGCAGGTGATGGG - Intronic
1031473425 7:122193928-122193950 CTTTCCATCTTGCAGGTTCTGGG + Intergenic
1032162391 7:129520831-129520853 CCTCCCATCTGGCAGGTGCTGGG + Intergenic
1032238758 7:130145222-130145244 CCTGCCATGTGGCAGCTGATTGG - Intergenic
1033286752 7:140048044-140048066 CTCTCTGTGTGGCAGGTGGACGG + Intronic
1035053425 7:156017895-156017917 CTTTCCATGTGTCACTTGGCTGG + Intergenic
1035485727 7:159224252-159224274 CATTCTATGTGGCAGGTATTTGG + Intergenic
1036052781 8:5218552-5218574 CTTTCCATGTGGAAGGCATTTGG - Intergenic
1036658474 8:10692480-10692502 ATTCCCATGTGCCAGGTGCTGGG - Intronic
1038383593 8:27119902-27119924 CTTTCTGTGTGGCAAGTGGCAGG + Intergenic
1039018562 8:33180546-33180568 CTTACCTGGTGGCAGGAGGTTGG - Intergenic
1039389551 8:37166570-37166592 CTTTCCAGATGGCATGTGTTTGG + Intergenic
1043293610 8:78636360-78636382 CTTTCCAAGTGGCAGGAGCCAGG - Intergenic
1043526562 8:81104089-81104111 CCTACCATGTGGAAGGTGGGTGG - Intronic
1045416042 8:101968631-101968653 CTTTCCTTGTGCCAGGTACTGGG - Intronic
1046750178 8:117918748-117918770 CATTCCATGTGGCATCTGCTGGG - Intronic
1048052188 8:130828556-130828578 CTTTCCATGAGGCAGATTGTTGG + Intronic
1048477409 8:134755947-134755969 ATTACCATGTGCCAGGTGCTAGG - Intergenic
1048551370 8:135436543-135436565 CTTACCATGTGACAGGCGCTGGG + Intergenic
1049531019 8:143155316-143155338 TTTACAATGTGGCAGGAGGTAGG - Intergenic
1051671728 9:19517242-19517264 ATTTCCAAGTGGCTGGTGATAGG + Intronic
1052318676 9:27143843-27143865 CCTTCCATGTGGCATCTGGCAGG + Intronic
1054171666 9:61845668-61845690 CTTCCTATGTGGCATGTGCTAGG - Intergenic
1054665868 9:67735144-67735166 CTTCCTATGTGGCATGTGCTAGG + Intergenic
1057252896 9:93518255-93518277 CTTTGCTTGTGGCAGGTGCAGGG + Intronic
1057747687 9:97764860-97764882 ATTACCATTTGGGAGGTGGTGGG - Intergenic
1057862706 9:98654446-98654468 CTTTCTATGTGCCAGATGGTGGG + Intronic
1060801077 9:126546214-126546236 CCATCCATGTGGGAGGTGGGAGG + Intergenic
1062191221 9:135248882-135248904 CTTCTCAGGTGTCAGGTGGTGGG - Intergenic
1185735320 X:2491422-2491444 TTTCCCACGTGGCAGGTGCTTGG - Intronic
1187945062 X:24417763-24417785 CTTGCAAGTTGGCAGGTGGTTGG - Intergenic
1188743997 X:33819613-33819635 CTTGCCAAGTGTCAGGGGGTGGG - Intergenic
1191923044 X:66278133-66278155 CATTCCATGTGGATGGTGGCAGG + Intergenic
1193205885 X:78746937-78746959 CTTGCCATGGGGGAGGTGGGCGG + Intergenic
1194638395 X:96373547-96373569 GTTTCCATATGGCAGGTGCTTGG + Intergenic
1196013686 X:110915129-110915151 CATGCCATGTGGCAGGTGGTGGG + Intergenic
1196304706 X:114087444-114087466 CTCTGCATGTGGAAGGTGGAGGG + Intergenic
1196603283 X:117626259-117626281 TTTTCCATGGGGAAGGTAGTAGG - Intergenic
1197735019 X:129843868-129843890 CGTTCCATTTGGCCAGTGGTGGG - Exonic
1201977984 Y:19872911-19872933 CTTTCCATATGGCTGTTTGTTGG - Intergenic