ID: 905272277

View in Genome Browser
Species Human (GRCh38)
Location 1:36794893-36794915
Sequence GGACCCTGGATTGCAGCTCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 145
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 130}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905272274_905272277 0 Left 905272274 1:36794870-36794892 CCGTGTCTTGATGGAGACTTCTT 0: 1
1: 0
2: 0
3: 21
4: 219
Right 905272277 1:36794893-36794915 GGACCCTGGATTGCAGCTCTAGG 0: 1
1: 0
2: 0
3: 14
4: 130
905272271_905272277 3 Left 905272271 1:36794867-36794889 CCCCCGTGTCTTGATGGAGACTT 0: 1
1: 0
2: 0
3: 2
4: 106
Right 905272277 1:36794893-36794915 GGACCCTGGATTGCAGCTCTAGG 0: 1
1: 0
2: 0
3: 14
4: 130
905272272_905272277 2 Left 905272272 1:36794868-36794890 CCCCGTGTCTTGATGGAGACTTC 0: 1
1: 0
2: 0
3: 3
4: 91
Right 905272277 1:36794893-36794915 GGACCCTGGATTGCAGCTCTAGG 0: 1
1: 0
2: 0
3: 14
4: 130
905272273_905272277 1 Left 905272273 1:36794869-36794891 CCCGTGTCTTGATGGAGACTTCT 0: 1
1: 0
2: 1
3: 10
4: 175
Right 905272277 1:36794893-36794915 GGACCCTGGATTGCAGCTCTAGG 0: 1
1: 0
2: 0
3: 14
4: 130

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905272277 Original CRISPR GGACCCTGGATTGCAGCTCT AGG Intergenic
900831894 1:4971392-4971414 GGATCCTGGATCGCAACTCCGGG - Intergenic
901624692 1:10617346-10617368 TGACCCTGGACAGCAGCACTGGG - Intronic
902078457 1:13805306-13805328 GGAGCTAGGATTCCAGCTCTGGG + Intronic
905272277 1:36794893-36794915 GGACCCTGGATTGCAGCTCTAGG + Intergenic
906942967 1:50272088-50272110 GGACAGTGGATGCCAGCTCTGGG - Intergenic
913203065 1:116511906-116511928 GGACACAGGATTGAAGATCTAGG + Intergenic
915067000 1:153232985-153233007 GCCCTCTGGATCGCAGCTCTTGG + Intergenic
915227195 1:154419917-154419939 GGACCCTGCAGCACAGCTCTGGG - Intronic
1062848239 10:724328-724350 GGACACTGGTATTCAGCTCTGGG + Intergenic
1065784035 10:29196460-29196482 AGACCCTGGTCTGCAGCTCTTGG - Intergenic
1067017159 10:42766497-42766519 GGAGCCTTGATTGCACCACTGGG + Intergenic
1067053648 10:43039148-43039170 GGACCCTGGAGTCCAGCTGCTGG - Intergenic
1070280244 10:75043473-75043495 CGGGCCTTGATTGCAGCTCTGGG - Intronic
1072047032 10:91667207-91667229 AGACCCTGGATGGCTCCTCTGGG - Intergenic
1074940995 10:118236000-118236022 GGCCCCCGGAGTGCAGCTCAGGG - Intergenic
1074993428 10:118732752-118732774 TGACCCTGGGAAGCAGCTCTAGG - Intronic
1075587725 10:123669507-123669529 GGACCCAGGAGTGCTGGTCTTGG + Intronic
1076624185 10:131811468-131811490 GGACCGTGGCCAGCAGCTCTTGG + Intergenic
1076624789 10:131815159-131815181 GGACCGTGGCCAGCAGCTCTTGG + Intergenic
1083776083 11:64894898-64894920 GGCCCGTGGGCTGCAGCTCTTGG + Exonic
1085029080 11:73258709-73258731 GGACCCTGGGTTTCTGCCCTGGG + Intergenic
1089329551 11:117680136-117680158 GGAACCTGGATGGCAGAGCTAGG - Intronic
1094321273 12:29186278-29186300 GGCCCCCATATTGCAGCTCTAGG + Intronic
1095418119 12:41998035-41998057 GGTCCCTGGAATGCAGCTCAGGG - Intergenic
1096393918 12:51250967-51250989 GGAAGATGGATTGCAGCCCTGGG - Intronic
1104548552 12:129734017-129734039 TGATACTGGATTGCAGCTGTGGG - Intronic
1106862184 13:33921690-33921712 GCACCCTGGAATGGAGCCCTGGG + Intronic
1107073615 13:36297957-36297979 CGACCCTGGATAACAGCTCCAGG + Intergenic
1108045018 13:46375161-46375183 GAACCCTGATATGCAGCTCTAGG - Intronic
1109861520 13:68205669-68205691 GGACCCTGGAATTTAGTTCTTGG - Intergenic
1111664717 13:91252413-91252435 GGCCTTTGGATTGCAGATCTTGG + Intergenic
1114401287 14:22413250-22413272 GCCCCCTGGATTGCAGCATTTGG + Intergenic
1118056549 14:62085080-62085102 GAACCTTGGACTGCAGCTCTGGG - Intronic
1122358140 14:101136565-101136587 GGGCCCTGGCTTCAAGCTCTGGG - Intergenic
1122834193 14:104423171-104423193 TGACCCTGGTTTACAGCTTTCGG + Intergenic
1123853780 15:24385719-24385741 GGTCCCTTGATTGGGGCTCTAGG - Intergenic
1129743291 15:78000708-78000730 GTCCCCTGGACTGCAGCTGTTGG - Intronic
1130199520 15:81811939-81811961 GGCCCCTGGACTGCATTTCTTGG - Intergenic
1132005367 15:98221659-98221681 GGAAACTGGATTGCAGGTCAGGG + Intergenic
1132380907 15:101366214-101366236 GGACCTGGGATGGCAGATCTTGG + Exonic
1133406414 16:5528145-5528167 GGACCCAGAAGTGCAGCCCTGGG - Intergenic
1133642552 16:7731695-7731717 TGACCTTGAATTTCAGCTCTGGG + Intergenic
1133725367 16:8532479-8532501 TGGCCTTGGATAGCAGCTCTGGG - Intergenic
1134536315 16:15029352-15029374 GGGCACTGAATAGCAGCTCTAGG + Intronic
1134833654 16:17344030-17344052 GGACCGTGGTTTTCAGCTCAGGG + Intronic
1136462510 16:30420482-30420504 TGACCCTGGAATGCAGCTTTAGG - Intronic
1138211880 16:55170011-55170033 GGTCCCTGGATCCCAGCTCTGGG - Intergenic
1138239958 16:55419402-55419424 GGACGGTGGAGTGCAGGTCTGGG - Intronic
1139859753 16:70011433-70011455 GGGCACTGAATAGCAGCTCTAGG - Intergenic
1140248927 16:73277391-73277413 GCTCCCTGGATTTTAGCTCTAGG + Intergenic
1140971822 16:80020661-80020683 TGACCATGGATTGAAGCTCAGGG - Intergenic
1141415646 16:83870676-83870698 GGTCCCTGCAATGCTGCTCTTGG + Intergenic
1141575245 16:84959282-84959304 GGCCCCTGGAGTGCAGTGCTGGG + Intergenic
1142201583 16:88763569-88763591 AGACCCTGGCTGGCAGCTCCAGG - Intronic
1142770116 17:2090496-2090518 GGACCCTGGATGCAAGCTCTAGG + Intronic
1144539085 17:16121575-16121597 TGTCTCTGGATTGCAGGTCTAGG - Intronic
1152577434 17:81149101-81149123 CGGCCCCGGAATGCAGCTCTCGG - Intronic
1156756574 18:40535214-40535236 GGACCCTGTAAGGCAGCTTTAGG + Intergenic
1158027829 18:52923058-52923080 TGACCCAGGGTTTCAGCTCTAGG + Intronic
1158185234 18:54763868-54763890 GGAGCCTGGTTTTCAACTCTTGG + Intronic
1159249937 18:65862825-65862847 GGCCTCTGCATTGCAGGTCTGGG - Exonic
1163004439 19:14388750-14388772 GAACCCTGGATTGCAGCGACAGG - Exonic
1163063023 19:14773984-14774006 GAACCCTGGATTGCAGCGACAGG + Exonic
1163201794 19:15774971-15774993 GGACCCTGGGTCCCAGATCTTGG + Intergenic
1163371018 19:16901339-16901361 GGACCTTGAATTCCACCTCTGGG - Intronic
1165074533 19:33273548-33273570 GGCCCCAGGACTGCTGCTCTTGG + Intergenic
1165472888 19:36013751-36013773 GGGCTCTGGAGTGCAGCCCTGGG - Intronic
1168409591 19:56131208-56131230 GGCCCCTGGATCACAGCTCTGGG - Intergenic
925217149 2:2106854-2106876 GGACACTGGATGTCTGCTCTGGG - Intronic
927905066 2:26849459-26849481 GGACCCAGGATGGCAGATCCGGG + Intronic
933230274 2:79799055-79799077 GGGTCCTGGATTGCAAATCTGGG - Intronic
936485025 2:112918108-112918130 GGACCCTGGCGTGCTGCTGTAGG + Intronic
937399387 2:121568743-121568765 GGACCCTGGAAAGCAACTCTTGG - Intronic
938612234 2:132959688-132959710 GGATCCTGGAGGGCAGGTCTGGG + Intronic
938637415 2:133243910-133243932 TGACCCTGAATTGCAGCTTGTGG - Intronic
943032153 2:182698308-182698330 GGACCCTGAAATTCAGCTCTTGG + Intergenic
947993705 2:234508981-234509003 GGACTCTGGACAGTAGCTCTGGG + Intergenic
948506965 2:238434992-238435014 GGGCCCTGGTTTGGTGCTCTGGG + Intronic
948798891 2:240421215-240421237 GGACCCTGGAAGGCAGCTGCTGG + Intergenic
948863441 2:240763828-240763850 GGACCCTGGACCCCAGCCCTGGG - Intronic
948865168 2:240771494-240771516 GGGGCCTGGAGTGCAGCTGTGGG - Intronic
948873456 2:240815424-240815446 GGCTCCTGAAATGCAGCTCTAGG - Intronic
1168816283 20:739476-739498 GGACCCTGGACTTCAGCTCCTGG - Intergenic
1172386734 20:34539293-34539315 GCAGCCTGGATTCCAGCTCCAGG - Intronic
1172978548 20:38924284-38924306 GGACCCTGGATACCAGCGCAGGG + Intergenic
1175198152 20:57260345-57260367 GGACCCTGGATTCCAGATGCAGG - Intronic
1176139407 20:63538383-63538405 GGTCCCTGGGTTGGAGCTCCCGG - Intergenic
1177047960 21:16194518-16194540 GGCCTCTGGGTGGCAGCTCTGGG + Intergenic
1177709849 21:24760329-24760351 AGACCCTGTATTGAAGATCTGGG + Intergenic
1178834540 21:36085387-36085409 GGGACCTGGATTTTAGCTCTAGG - Intergenic
1179544040 21:42102578-42102600 GGGCCCTGGCTTCCAGCTATGGG + Exonic
1182364082 22:29766349-29766371 GCACCCTGGGTAGCTGCTCTGGG - Intronic
1184454842 22:44603830-44603852 GCACCCTCGATTGCAGCTGTTGG - Intergenic
949597975 3:5567700-5567722 GGAGCCTGGATTGATGCTGTGGG - Intergenic
950025888 3:9819686-9819708 GGTCCCTGGATTACAGGACTAGG - Intronic
950551034 3:13665999-13666021 GGGCCCTGCCTTGCTGCTCTTGG + Intergenic
950981670 3:17314016-17314038 TGACCCTGTCTTGCAGCTCAGGG + Intronic
951371718 3:21857941-21857963 TGGCCCTGGATTGCATTTCTAGG - Intronic
956603544 3:71049196-71049218 AGACCTTTGACTGCAGCTCTAGG - Intronic
960912801 3:122666090-122666112 GGACCCTTGGTTGCAGCTGATGG + Intergenic
961646903 3:128397574-128397596 GGACACTGGACTGCAGCCCTGGG - Intronic
961668634 3:128510084-128510106 GGACCCAGGATTACAACTCCTGG + Intergenic
962223839 3:133587693-133587715 GAACGCTGTATTGAAGCTCTAGG - Intronic
965530127 3:169763394-169763416 GGACACTGCACTCCAGCTCTGGG + Intergenic
968814227 4:2813358-2813380 GGACTCTGGTTTGAAGCTCAAGG + Intronic
968960213 4:3739589-3739611 GGACCCAGAACTGCAGCTGTTGG - Intergenic
976130647 4:81880473-81880495 GGACCCTGTATTCCAGTTATAGG + Intronic
979524479 4:121702912-121702934 GGACACTGGAATGTAGATCTTGG + Intergenic
985656227 5:1132777-1132799 GGACACTGCAGTGCAGTTCTTGG - Intergenic
992231714 5:74670587-74670609 CCACCCTGGCTGGCAGCTCTGGG - Intronic
992409666 5:76492985-76493007 AGATCGTGGATTGCAGATCTGGG + Intronic
998546053 5:143028892-143028914 GGTCCCTGGAGTGCTGATCTGGG + Intronic
1002058033 5:176609905-176609927 GGACCCTGGACAGCGGCTCCGGG + Intronic
1002675812 5:180911583-180911605 GTACCCTGGATTCCACCTCTCGG - Exonic
1002718449 5:181243647-181243669 GGACCCGAGATTGCAGGGCTGGG - Intronic
1006145460 6:31956481-31956503 CCACCTTGGATTGGAGCTCTTGG - Intronic
1007402964 6:41614975-41614997 GAGCCCTGGATTGCAGCCATGGG - Intergenic
1008515479 6:52314749-52314771 AGAGCCTGGATTGCTGGTCTGGG + Intergenic
1012318578 6:97813753-97813775 CAACTCTGAATTGCAGCTCTGGG + Intergenic
1016388993 6:143556609-143556631 GGAAGCTGAATTGCTGCTCTAGG - Intronic
1017780059 6:157708864-157708886 GGACCTTGGCTTTCATCTCTAGG - Intronic
1018903403 6:168062328-168062350 TGACCCTGGGTGACAGCTCTGGG + Intronic
1024849586 7:53695702-53695724 AGACCTTGGATTACAACTCTGGG + Intergenic
1029681844 7:102117009-102117031 GTCCCCTTGATTGCAGCACTGGG - Intronic
1031059696 7:117037012-117037034 GGACCCAGCATTGTGGCTCTAGG + Intronic
1034161075 7:148994734-148994756 GCCCCCGAGATTGCAGCTCTTGG + Intergenic
1034408438 7:150922260-150922282 TGATCCTGGATTGCAGCTAGTGG + Intergenic
1034896882 7:154881867-154881889 GGCACCTGGAATGCACCTCTAGG - Intronic
1035565349 8:637283-637305 GGTCCCAGGGTGGCAGCTCTGGG - Intronic
1038005951 8:23430703-23430725 GGACCCCGCCTTCCAGCTCTGGG - Exonic
1038426288 8:27466050-27466072 GGACCCTGGGTGCCAGCTATGGG + Intronic
1038614046 8:29076555-29076577 GGAGCCTGGACTCCAGCTGTAGG + Intronic
1044086044 8:87943301-87943323 GGGCTCTGGATCGCAGCTGTAGG + Intergenic
1044597535 8:93972921-93972943 GGCCCCAGGATCGCAGCTCTTGG - Intergenic
1046942163 8:119941832-119941854 AAACCCTGGTTTCCAGCTCTAGG + Intronic
1049961557 9:742446-742468 GGACTCTGGACGGGAGCTCTGGG + Intronic
1057250648 9:93498530-93498552 GGGCCCTGGGTTCTAGCTCTAGG - Intronic
1061013213 9:127967474-127967496 GGAGCCCAGCTTGCAGCTCTGGG - Intronic
1062131326 9:134895136-134895158 GGGCCCTGCATTGCAGCACAAGG + Intergenic
1062183411 9:135203206-135203228 GGACCCTGGTCTGTAGCTGTTGG + Intergenic
1062365666 9:136207854-136207876 GGTGCCTGGAGGGCAGCTCTGGG - Exonic
1190046334 X:47114004-47114026 GGCTCCTGGATGGCATCTCTAGG + Intergenic
1195248283 X:103017114-103017136 AGAGCCAGGATTGAAGCTCTGGG - Intergenic
1195401107 X:104462270-104462292 GGATCTTGGCTTTCAGCTCTTGG + Intergenic
1200134631 X:153868935-153868957 GGATCTTGGCTGGCAGCTCTAGG + Exonic