ID: 905272521

View in Genome Browser
Species Human (GRCh38)
Location 1:36796255-36796277
Sequence ACAGAGATCTGCAGCCTCCT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 341
Summary {0: 1, 1: 0, 2: 1, 3: 37, 4: 302}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905272518_905272521 -3 Left 905272518 1:36796235-36796257 CCGATCTGGGTGAGCCAGGGACA 0: 1
1: 0
2: 0
3: 23
4: 242
Right 905272521 1:36796255-36796277 ACAGAGATCTGCAGCCTCCTGGG 0: 1
1: 0
2: 1
3: 37
4: 302

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905272521 Original CRISPR ACAGAGATCTGCAGCCTCCT GGG Exonic
900093472 1:930582-930604 CCAGAGGTCTGCACCTTCCTGGG + Intronic
902075062 1:13777759-13777781 ACAGAAATCTGCAGTCACTTCGG - Intronic
904263357 1:29303878-29303900 ACTGAGGCCAGCAGCCTCCTGGG + Exonic
905188791 1:36216707-36216729 ACAGCTCACTGCAGCCTCCTGGG - Intergenic
905272521 1:36796255-36796277 ACAGAGATCTGCAGCCTCCTGGG + Exonic
906430386 1:45750987-45751009 ACTGAGATCCGCGGCCTTCTTGG - Intergenic
907561332 1:55391598-55391620 ACAGAGATCTTTCACCTCCTTGG + Intergenic
908315438 1:62927846-62927868 AGAGACATCTGCAGCTCCCTAGG - Intergenic
909240037 1:73201204-73201226 ACAGCTCACTGCAGCCTCCTGGG - Intergenic
912099900 1:106192078-106192100 ACAGAGATAGGAAGCCTCCCTGG + Intergenic
912099945 1:106192332-106192354 ACAGAGATATGAAGCCTCCCTGG + Intergenic
914735846 1:150415609-150415631 ACAGTTCACTGCAGCCTCCTTGG - Intronic
916725980 1:167524863-167524885 ACAGAGGACTGCAGCCACGTGGG + Intergenic
917259180 1:173148591-173148613 ACAGAGGTTTGCAACCTCCCTGG - Intergenic
917380901 1:174406832-174406854 ACAGCTCACTGCAGCCTCCTAGG - Intronic
917665030 1:177218138-177218160 ACAGTGATCAGCAGTCTCCTTGG + Intronic
919085294 1:192913814-192913836 ACTGAGAACTGCAAGCTCCTTGG - Intergenic
919653701 1:200177225-200177247 TCACAGATCTGCAGCTGCCTTGG + Exonic
920173729 1:204087377-204087399 ACAGATAGCTGCAGCCACCATGG - Intronic
920498104 1:206469730-206469752 ACAGACCCCTCCAGCCTCCTAGG + Intergenic
922152293 1:223016871-223016893 ACAGGGAACTGCACCCACCTGGG + Intergenic
923577725 1:235175028-235175050 ACTGTAATCTTCAGCCTCCTGGG - Intronic
924163027 1:241253412-241253434 ACAGAGATCTATGGCCACCTGGG - Intronic
1063019147 10:2108607-2108629 AAAGTGATCTTCAGCCTCCTTGG + Intergenic
1063081960 10:2775830-2775852 ACTGAGAGCTGGAGCCTCCAAGG - Intergenic
1063125362 10:3132249-3132271 CGCGAGAGCTGCAGCCTCCTTGG + Intronic
1063173019 10:3526583-3526605 AAAGAAATCTGCAGCGGCCTGGG + Intergenic
1064271408 10:13869643-13869665 ACAAAGAACTCCAGGCTCCTGGG + Intronic
1064271811 10:13872183-13872205 ACAGAGACCTGCAGCGCCCCCGG - Intronic
1065361323 10:24891689-24891711 ACAGCTCACTGCAGCCTCCTGGG - Intronic
1065642079 10:27793595-27793617 TCTAAGATCTTCAGCCTCCTAGG - Intergenic
1066470604 10:35694033-35694055 CCAGAGATTTGCAGGCTCCGTGG - Intergenic
1066612118 10:37260257-37260279 ACAGTGATTTGCTGCCTTCTTGG + Intronic
1066709068 10:38213723-38213745 ACAGTGCACTGCAGCCTCCAAGG - Intergenic
1066980434 10:42408770-42408792 ACAGTGCACTGCAGCCTCCAAGG + Intergenic
1067432708 10:46254438-46254460 TCAGGGATCTGCAGCATCCTAGG - Intergenic
1067440560 10:46307045-46307067 TCAGGGATCTGCAGCATCCTAGG + Intronic
1067551130 10:47237403-47237425 ACGGAGCCCTGGAGCCTCCTGGG + Intergenic
1067552709 10:47246664-47246686 ACAGAGAGCTGCATCCTCAATGG - Intergenic
1067576782 10:47414114-47414136 TCAGGGATCTGCAGTGTCCTAGG + Intergenic
1069366299 10:67697770-67697792 AAAAATATCTGCAGCCTCCAAGG + Intergenic
1070560947 10:77566205-77566227 ACAGAAAGCTGCAGCCCTCTGGG + Intronic
1071808362 10:89149588-89149610 ATAGAGATCTTTTGCCTCCTTGG + Intergenic
1073160981 10:101394729-101394751 ACAGGGAACTGCAGGCTACTGGG - Intronic
1073327021 10:102649001-102649023 ACACAGATGTGCAGCCACCCAGG - Intronic
1073619221 10:105029644-105029666 ACAGAGATCTTTTGACTCCTGGG - Intronic
1074126923 10:110536010-110536032 GCAGAGAGATGCTGCCTCCTGGG + Intergenic
1074256753 10:111810748-111810770 AGAGAGATGTGCAGCCACCTGGG + Intergenic
1075824674 10:125345030-125345052 GCACAGAGCTGCAGCCTTCTGGG + Intergenic
1076070467 10:127484430-127484452 ACAGAGCTCTCCAGACTCCTGGG + Intergenic
1076461899 10:130653561-130653583 GCAGAGGTGTGCAGCCTCCTCGG - Intergenic
1077151818 11:1076200-1076222 CCAGAGACATGCAGCCTCCAGGG - Intergenic
1077547453 11:3181118-3181140 ACATACATCAGCAGCCCCCTTGG - Intergenic
1081607792 11:44538029-44538051 AAAGAGACCTGCAGCCTACCCGG + Intergenic
1081704945 11:45177194-45177216 AAACAGAGCTGCAGACTCCTGGG + Intronic
1082775365 11:57240657-57240679 ACAGACATCTGCATCTTTCTGGG - Intergenic
1084901140 11:72310836-72310858 ACAGAGAGCTGCACACTGCTGGG + Intronic
1087088564 11:94244692-94244714 AGAGAGAGATGCAGCCTCCTTGG + Intergenic
1088863955 11:113828420-113828442 TCAGAGAGCTGCTGCCTCCCTGG - Intronic
1090665925 11:128914864-128914886 CCAGACGTCTGCAGCCTCCCAGG - Intronic
1093144102 12:15543917-15543939 ACACAGATGTGTTGCCTCCTGGG - Intronic
1095503779 12:42870059-42870081 ATAGAGATCTTCCACCTCCTTGG + Intergenic
1096661062 12:53124270-53124292 ACTGAGATCTGCAGACTTGTGGG + Exonic
1096750764 12:53757399-53757421 ACAGAGAGCTACAGCTGCCTTGG + Intergenic
1097258553 12:57699247-57699269 CCAGAGATCCACAGCCCCCTTGG - Intronic
1098062347 12:66576334-66576356 ACAGAGCTTTGCAGCATCCCCGG - Intronic
1099083070 12:78210644-78210666 ACTTAGTTCTGCTGCCTCCTTGG - Exonic
1099667850 12:85654116-85654138 ACAGAGATTTGAAGCCACCCTGG - Intergenic
1100174594 12:92015076-92015098 ACAGAGATCTTTCACCTCCTTGG + Intronic
1101834948 12:108288588-108288610 ACAGAGCCCTGCAGGTTCCTGGG - Exonic
1101904581 12:108815109-108815131 GAAGAGAGCTGCAGCCTGCTGGG + Intronic
1101949557 12:109164009-109164031 TGAGAGATGTGCAGCCTCATTGG + Intronic
1102472542 12:113167817-113167839 CTACAGATCTGCAGCCTCCTGGG - Intronic
1102930120 12:116855812-116855834 ACATTAATCTGCAGCCTCATTGG + Intergenic
1103330319 12:120149706-120149728 ACAGTCATCTGCAGCCTCAAGGG + Exonic
1103366758 12:120389529-120389551 TCAGAGGCCTGCAGCCCCCTGGG + Intergenic
1104667880 12:130660416-130660438 TCAGAGACCTCCATCCTCCTTGG - Intronic
1107926138 13:45263780-45263802 ACAGAGAGCTGCAACCCCCAGGG - Intronic
1110867128 13:80408111-80408133 ACAGAGATTTGAAACCTCCCTGG - Intergenic
1112080946 13:95969616-95969638 GCAGCCATCTGCAGCCTCATAGG + Intronic
1112872128 13:103985722-103985744 ACAGAGAATTGCAGTCTACTGGG + Intergenic
1113226834 13:108168676-108168698 ACAGAGATTTGCAACCTCTCTGG + Intergenic
1113768731 13:112895603-112895625 CCTGAGTTCTGCAGCCTCCGTGG + Intronic
1113932465 13:113975596-113975618 CCAGAGAGCTGAGGCCTCCTGGG - Intergenic
1116932306 14:50702570-50702592 ACAGAGATTTGGAGCCTCCCTGG - Intergenic
1119263566 14:73251883-73251905 ACAGAGCTTGGCAGCCTCTTGGG - Intronic
1121101766 14:91254305-91254327 ACTTAGGTTTGCAGCCTCCTGGG + Intergenic
1121644642 14:95509417-95509439 CCAGTGATCTGGACCCTCCTGGG + Intergenic
1122179664 14:99946021-99946043 ACAGCTCACTGCAGCCTCCTGGG - Intergenic
1122315052 14:100821068-100821090 ACAGAGAACTGCAGAGGCCTGGG - Intergenic
1123113628 14:105884089-105884111 AGAGGCCTCTGCAGCCTCCTGGG + Intergenic
1123115853 14:105893728-105893750 AGAGGCCTCTGCAGCCTCCTGGG + Intergenic
1123117878 14:105902838-105902860 AGAGGCCTCTGCAGCCTCCTGGG + Intergenic
1123120095 14:105912443-105912465 AGAGGCCTCTGCAGCCTCCTGGG + Intergenic
1123402833 15:20004029-20004051 AGAGGCCTCTGCAGCCTCCTGGG + Intergenic
1123512170 15:21010683-21010705 AGAGGCCTCTGCAGCCTCCTGGG + Intergenic
1124375410 15:29126198-29126220 ACTGAGACCTGCAGCATCCAAGG + Intronic
1125539508 15:40461907-40461929 CCAGGGATCTGCAGCCTTCTAGG - Exonic
1125754707 15:42055618-42055640 CCAGAGATCTGAAGCCACATGGG + Intergenic
1127358011 15:58219985-58220007 ATAGAGATCTTTTGCCTCCTTGG + Intronic
1127826266 15:62706460-62706482 TCAGTGTTCTGCAGCCTTCTGGG - Intronic
1127836331 15:62793954-62793976 ACAGGGCTGTCCAGCCTCCTGGG + Intronic
1131552435 15:93368999-93369021 ACAGGGATCTGAAGCCTCCTGGG + Intergenic
1131678553 15:94697642-94697664 AAAGATAACTGCAGTCTCCTTGG + Intergenic
1132895139 16:2225335-2225357 CCAGCCATCTGCAGCCTCATAGG - Intronic
1133256663 16:4521323-4521345 AATGTGATCTGCAGTCTCCTGGG - Intronic
1134225366 16:12385873-12385895 AACGGGATGTGCAGCCTCCTGGG + Intronic
1134402252 16:13920638-13920660 CCAGGGACCTGCAGCCTTCTCGG - Intronic
1136548115 16:30966572-30966594 ACAAAGCTCTGCTGCCTCCCAGG - Intronic
1138126397 16:54442467-54442489 AGGGAGACCTCCAGCCTCCTGGG - Intergenic
1138198782 16:55073809-55073831 ACATGGTTCTGCATCCTCCTGGG - Intergenic
1139576547 16:67846023-67846045 AAAGAGATCTGCAGCCAACTTGG - Intronic
1140353309 16:74283232-74283254 ACAGAGAACTCCATTCTCCTAGG + Intergenic
1141221408 16:82072521-82072543 ACAGAGTACTGCCTCCTCCTTGG + Intronic
1141764980 16:86052212-86052234 AGAGAGTTCTGCAGCATCCTAGG - Intergenic
1141836945 16:86547011-86547033 TCAGAGAGCTCCAGCCTGCTGGG - Intronic
1142170208 16:88617892-88617914 GCAGAGATCTTGAGACTCCTGGG - Intronic
1142286586 16:89173917-89173939 ACAGAGAACCCCAGCCTGCTGGG + Intronic
1142996092 17:3761447-3761469 ACAGGCACCTGTAGCCTCCTGGG - Exonic
1145945036 17:28767499-28767521 ACAGAGTTCTGCTGTCACCTAGG + Intronic
1146565787 17:33911683-33911705 ACAGAAATTTGCAAACTCCTGGG - Intronic
1146713072 17:35059408-35059430 ACAGACATGTGCAGCCTTCTTGG + Intronic
1146892535 17:36515239-36515261 CCAGAGACCTGCAGCCACCTTGG - Intronic
1150885080 17:69075921-69075943 ACAGAGATCTTTCACCTCCTTGG + Intergenic
1151557685 17:74854836-74854858 ACCCAGATCTGCGGCCTCCTGGG - Exonic
1152455984 17:80416412-80416434 CTGGAGATCTGCATCCTCCTGGG + Intronic
1152510249 17:80781975-80781997 TCAGAGCTCTGGAGCCACCTCGG + Intronic
1152803247 17:82341842-82341864 ACAGCTCACTGCAGCCTCCTGGG - Intergenic
1203167854 17_GL000205v2_random:114478-114500 AGAGAGAGCTCCAGCTTCCTAGG - Intergenic
1153215929 18:2821145-2821167 ACATACATCAGCAGCCTCCCTGG - Intergenic
1153551969 18:6271776-6271798 ACAGAGACCTGGGGGCTCCTGGG + Intronic
1153952064 18:10065904-10065926 ACAGATATCTGAAACCTCCGGGG - Intergenic
1155168367 18:23248952-23248974 CCAGGCAGCTGCAGCCTCCTGGG - Intronic
1155209470 18:23587860-23587882 ATAGACAACTGTAGCCTCCTGGG - Intergenic
1155922783 18:31619899-31619921 ACACATATCTGCAGTTTCCTTGG - Intergenic
1157291606 18:46413457-46413479 ACAGAGCTCTGCAGGCTCTGTGG + Intronic
1157657534 18:49405926-49405948 ATAGAGATCTTCCACCTCCTCGG + Intronic
1158624125 18:59057044-59057066 ACACAGATCCTCATCCTCCTTGG + Intergenic
1159880848 18:73857259-73857281 ACAGAGAACTGCCCCCTCCAGGG + Intergenic
1161457120 19:4375034-4375056 TCAGTGCTCTGCTGCCTCCTGGG - Intronic
1161912260 19:7203428-7203450 AGAGAGAACCGCAGCCTCCATGG + Intronic
1162260939 19:9533493-9533515 ACAGAGATCTTCATTCTTCTGGG + Intronic
1162962368 19:14135895-14135917 ACGGAGATCTTCAGCCACCGTGG - Intronic
1163084573 19:14970143-14970165 ACAGCTCGCTGCAGCCTCCTGGG + Intronic
1163557469 19:18000946-18000968 GCTGAGATCTGCGGCCGCCTCGG + Intergenic
1164836090 19:31355967-31355989 AGAGATAGCTGCAGCCACCTAGG + Intergenic
1164843276 19:31410744-31410766 ACAGTGCTCTGCAGCCCCCATGG - Intergenic
1168650434 19:58088910-58088932 ACAGGGACCTGCAGGCTCCAGGG + Intronic
926904535 2:17793572-17793594 ACTGTCATCTGCAGCCTCCTGGG + Intronic
928023611 2:27722383-27722405 ACTGAGGGCTGCAGGCTCCTGGG - Intergenic
928081110 2:28313128-28313150 ACAGAGGCCTTCAGCCTCCTGGG - Intronic
928199941 2:29241424-29241446 CCAGAGATTTGCAGCTTCCCCGG - Intronic
929528080 2:42724953-42724975 ACAGAGACCTTCAGCCTTTTTGG + Intronic
929580316 2:43078138-43078160 ACTGAGATCTGCTTCCACCTTGG - Intergenic
929752200 2:44727320-44727342 GCAGAGATCTTCTACCTCCTTGG + Intronic
930601701 2:53451277-53451299 ACAGAAGTCTCCAGCTTCCTGGG + Intergenic
934063911 2:88321880-88321902 ACAGAGACCTGCTGCCTGTTAGG - Intergenic
934623896 2:95832916-95832938 ACAGAGATCTGAATTCTCCCTGG - Intergenic
934624153 2:95833940-95833962 ACAGAGATTTGAATTCTCCTTGG - Intergenic
934624345 2:95834779-95834801 ACAGAGATCTGAATTCTCCCTGG - Intergenic
934755310 2:96820470-96820492 GCAGAGAGCCTCAGCCTCCTAGG + Intronic
934809262 2:97266731-97266753 ACAGAGATCTGAATTCTCCCTGG + Intergenic
934809726 2:97268678-97268700 ACAGAGATCTGAATTCTCCCTGG + Intergenic
934827969 2:97439307-97439329 ACAGAGATCTGAATTCTCCCTGG - Intergenic
934828187 2:97490221-97490243 ACAGAGATCTGAATTCTCCCTGG - Intergenic
934905743 2:98200464-98200486 ACTGCAATCTCCAGCCTCCTGGG - Intronic
935834561 2:107036781-107036803 ACAGAGATTTGCAACCTCCCTGG + Intergenic
937430264 2:121832221-121832243 GGAGAGGGCTGCAGCCTCCTGGG + Intergenic
937950484 2:127383388-127383410 ATAGAGATCTGTTACCTCCTTGG + Intronic
939391115 2:141570721-141570743 ACAGAGCCGTCCAGCCTCCTTGG - Intronic
939892990 2:147759605-147759627 ACAGAGATGGGAAGCCTCCAGGG + Intergenic
940185825 2:150984141-150984163 CCACATATTTGCAGCCTCCTGGG + Intergenic
940761754 2:157746176-157746198 ACTGTGATCTGCAAGCTCCTGGG + Intronic
941967891 2:171317894-171317916 GCTGTGCTCTGCAGCCTCCTGGG + Exonic
943420429 2:187661853-187661875 ACAGAGATCTGAAATCCCCTGGG - Intergenic
943606553 2:189983692-189983714 ACAGGGTTCTGCAACTTCCTGGG + Intronic
946636091 2:221728760-221728782 ACAGAGATCTTTCCCCTCCTTGG - Intergenic
948526278 2:238572827-238572849 ACTGAGATCTGCTGTCTCTTGGG - Intergenic
948803152 2:240441887-240441909 GCCCAGAGCTGCAGCCTCCTTGG + Intronic
1168777319 20:458814-458836 AAACAGATCTGCAGACTCTTTGG + Intronic
1171171598 20:23020276-23020298 AGAGACCTCTGCAGCCTTCTGGG - Intergenic
1172527590 20:35609446-35609468 TCAAAGATTTGCAGCCTCCATGG - Intergenic
1173402378 20:42736910-42736932 ACAGAGGTCTGCACCTTCCCAGG - Intronic
1175380661 20:58560220-58560242 ACAGAGGTCTGCAGTCACATGGG + Intergenic
1175723198 20:61300100-61300122 ACAGAGACGTCCAGCCTGCTTGG + Intronic
1175954971 20:62604568-62604590 CCCAAGGTCTGCAGCCTCCTCGG + Intergenic
1176403903 21:6344658-6344680 AGAGAGAGCTCCAGCTTCCTAGG + Intergenic
1176433254 21:6644446-6644468 AGAGAGAGCTCCAGCTTCCTAGG - Intergenic
1176977168 21:15335116-15335138 ACAGAGATTTGTAACCTCCCTGG - Intergenic
1177294388 21:19156031-19156053 GCAGAGATCTTCCACCTCCTTGG + Intergenic
1178082311 21:29077811-29077833 ACAGAAACCTACAGTCTCCTTGG - Intronic
1178915412 21:36703124-36703146 ACAGAGGCTGGCAGCCTCCTGGG - Intronic
1180154401 21:45971100-45971122 ACAGTGACCTGTAGCCTGCTGGG - Intergenic
1180215184 21:46318977-46318999 GCAGAGGTCAGCACCCTCCTCGG + Intronic
1180248280 21:46562882-46562904 ACACAGCTCTGCATCATCCTTGG + Intronic
1180945079 22:19688333-19688355 CCAGCTGTCTGCAGCCTCCTGGG + Intergenic
1181171745 22:21013976-21013998 ACAGAGGTCTCCTGCCTCCTCGG + Intronic
1181346057 22:22221425-22221447 ACTGAGCTCTCCAGCCTCCAGGG + Intergenic
1182668061 22:31973393-31973415 ACAGAGTTCTACAACATCCTTGG - Intergenic
1184467438 22:44677122-44677144 GCTGAGGTCTGCACCCTCCTGGG - Exonic
1185070774 22:48654515-48654537 ACAGAGAGCTGCAGGGTCCTGGG + Intronic
951533657 3:23722136-23722158 ACTGCAACCTGCAGCCTCCTAGG - Intergenic
951606282 3:24438662-24438684 ACAGAAAACTGAAGCCTGCTGGG + Intronic
951758845 3:26122641-26122663 ATAGAGATCTTTCGCCTCCTTGG - Intergenic
952931586 3:38365047-38365069 ACAGAGCTCATCACCCTCCTGGG - Intronic
953189799 3:40674409-40674431 ACAGAGATCTTTCACCTCCTTGG - Intergenic
953723469 3:45376898-45376920 ACAGAGATCTTTCACCTCCTTGG + Intergenic
954716669 3:52530256-52530278 AAAGCCAACTGCAGCCTCCTGGG - Intronic
954871883 3:53773518-53773540 GCAGAGATCTACAGCCACCTGGG - Intronic
954925012 3:54226376-54226398 TCACAGCTCTGCAACCTCCTGGG + Intronic
955681362 3:61505354-61505376 ACAGAGATTTGCATTCTCCCCGG - Intergenic
955727032 3:61944143-61944165 AGGGAGTTCTGCAGCATCCTGGG + Intronic
960841454 3:121963311-121963333 ACAGAGATTTAAAGCCTCCCTGG + Intergenic
960845559 3:122001424-122001446 ACAGTGATCTTCATCATCCTGGG - Exonic
961487626 3:127227722-127227744 ACAGTGGCCTGCAGGCTCCTGGG - Intergenic
961705077 3:128778422-128778444 ACATGGATCTGCAGCCCTCTAGG - Intronic
963052930 3:141157948-141157970 ACAGAGATTTGAATTCTCCTCGG + Intergenic
966583292 3:181592603-181592625 GCAGAGATCTTTCGCCTCCTTGG + Intergenic
966974217 3:185070674-185070696 AGAGAGCTCTGCAGCCACCAGGG + Intergenic
967434332 3:189427035-189427057 ACAGAGATCTTTCACCTCCTTGG - Intergenic
967936254 3:194730222-194730244 ACAGAGATTTGCAACCTTTTTGG + Intergenic
968908448 4:3464968-3464990 GTTGAGATCTGCAGCCTTCTGGG + Intronic
972007987 4:34135815-34135837 ACAGAGATCTTCCACCTCCTTGG + Intergenic
972673605 4:41237949-41237971 GCAGAGGTCTGCAGGCACCTTGG - Intergenic
974180069 4:58373036-58373058 GCAGAGATCTTCAACCTCCTTGG + Intergenic
976000843 4:80371391-80371413 ACAAATTTCTGCAGCCTGCTTGG + Intronic
977394156 4:96450832-96450854 ACAGAGATTTGAAACCTCCCTGG - Intergenic
978704688 4:111692611-111692633 ACAGGGATCTCCAACCCCCTGGG + Intergenic
978923652 4:114217066-114217088 ACAGAGACCAGGAACCTCCTTGG + Intergenic
979928597 4:126600446-126600468 AGAGATATTTGCAGCCTACTTGG - Intergenic
979948892 4:126867067-126867089 ACAAATGTCTGCAGCCTGCTTGG + Intergenic
980553637 4:134373144-134373166 ACAGAGATCTTTCACCTCCTTGG - Intergenic
981951964 4:150420164-150420186 ACAGCTCACTGCAGCCTCCTGGG - Intronic
981951994 4:150421751-150421773 GCAGAGAGCTGCACCTTCCTGGG - Intronic
982218398 4:153103115-153103137 ATAGAGATCTTTTGCCTCCTTGG + Intergenic
982887558 4:160800931-160800953 GCAGAGATCTTCTACCTCCTTGG - Intergenic
983921864 4:173354774-173354796 ACAGCTCGCTGCAGCCTCCTAGG - Intergenic
985051152 4:185993209-185993231 ACAGAGATGTGCAGTCTAGTTGG - Intergenic
985644089 5:1076996-1077018 GCACAGCTCTGAAGCCTCCTGGG - Intronic
985759463 5:1737653-1737675 ACAGGGAGCTCCAGCCTCCCAGG - Intergenic
985834057 5:2257690-2257712 ACGGAGATATGAAGCCCCCTGGG + Intergenic
987472934 5:18354858-18354880 CCAGAGAACTGAAACCTCCTAGG - Intergenic
987834707 5:23146260-23146282 ACTGAGATGTCCAGCCTCCTTGG + Intergenic
988486910 5:31674956-31674978 ACAGGGATCTGGTGCCTTCTGGG - Intronic
988722565 5:33892677-33892699 ACAGAGATCTGCAGACTCAGAGG - Intergenic
993749189 5:91645567-91645589 ACAGAGCTCTGCAGCAGCCGCGG - Intergenic
996440224 5:123481622-123481644 AGAGAGATGTGCAGTCTCCCTGG - Intergenic
998320173 5:141222607-141222629 ACTAAGGTATGCAGCCTCCTAGG + Intergenic
999184959 5:149700508-149700530 CCTGATCTCTGCAGCCTCCTTGG + Intergenic
999232628 5:150070477-150070499 TCAGAGCTCTCCAGCCTCCTGGG + Exonic
999611004 5:153369603-153369625 ACAGACATCAGCACCCTCTTAGG + Intergenic
999868857 5:155729302-155729324 TTAGAGATCCGCAGCCGCCTGGG + Intergenic
1000021540 5:157322995-157323017 CCAGGGATCGGCAGCCTCTTCGG - Exonic
1002303159 5:178268923-178268945 ACTGAGATGTGGAGCTTCCTTGG - Intronic
1002419116 5:179136329-179136351 ACAGACATTTGCAGCCTCGGAGG - Intronic
1002605535 5:180380768-180380790 TCTGAGGACTGCAGCCTCCTGGG - Intergenic
1002777347 6:340432-340454 ACAGAGAGCTGCTTCCTCTTCGG - Intronic
1004535220 6:16493990-16494012 ACAGGGCTCTGCACCCTGCTGGG - Intronic
1005096125 6:22118463-22118485 GAAAAGATCTACAGCCTCCTCGG - Intergenic
1008390418 6:50944625-50944647 ACAGTGAGATGCAGCCTGCTTGG - Intergenic
1010786986 6:80014980-80015002 ACACTGAACTGCAACCTCCTTGG - Intronic
1012231760 6:96768456-96768478 ACAGAGCTGTGCAACCTGCTTGG + Intergenic
1013428986 6:110039249-110039271 ACAGCTCACTGCAGCCTCCTGGG - Intergenic
1014124278 6:117759184-117759206 ACAGAGATTTGAAACCTCCCTGG + Intergenic
1014416967 6:121195256-121195278 ACAGATATCTTAAGCCTCATTGG - Intronic
1015268566 6:131315459-131315481 ACAGAGATCTTTTACCTCCTTGG + Intergenic
1018673772 6:166201533-166201555 GCAGAATTCTGCAGCCTCCATGG + Intergenic
1018948894 6:168365545-168365567 ACAGACACCTGGAGCCTCCGTGG + Intergenic
1019489511 7:1305603-1305625 ACTGAGCTCATCAGCCTCCTGGG + Intergenic
1020022452 7:4877363-4877385 ACAGCTCACTGCAGCCTCCTGGG - Intronic
1020099108 7:5384664-5384686 AAAGAGATCTCCTGCCTCCCAGG + Intronic
1021952337 7:25787405-25787427 ACAGAGGCCTGCAGCTTGCTGGG + Intergenic
1022944043 7:35264525-35264547 CCAGAGTTCAGCAGCCTCTTAGG - Intergenic
1023802878 7:43850159-43850181 ACAAAGGTTTGCAGCCTCCAGGG + Intergenic
1024253137 7:47521236-47521258 AGAGGTATTTGCAGCCTCCTTGG - Intronic
1024433709 7:49323575-49323597 CCTTAGATCTCCAGCCTCCTAGG - Intergenic
1026459656 7:70602470-70602492 CCGGAGACCTGGAGCCTCCTGGG - Intronic
1026501409 7:70946313-70946335 AAGGAGATCTGCTGCCTTCTGGG + Intergenic
1028431639 7:90753919-90753941 GCAGAGATCTTTAACCTCCTTGG - Intronic
1028985707 7:97006693-97006715 ACTGCGCTCTCCAGCCTCCTGGG + Intronic
1032155582 7:129464921-129464943 ACAGACATCTGCACCTTTCTAGG - Intronic
1033694238 7:143771077-143771099 CCAGAGATCAGCAGACTCATGGG - Intergenic
1035172559 7:157026408-157026430 ACACAGATCTTTCGCCTCCTTGG + Intergenic
1035698028 8:1615030-1615052 GCAGACAGCTGCAGTCTCCTTGG + Intronic
1037680964 8:21097145-21097167 CCAGAGCTCTTCAGCCTCCAAGG - Intergenic
1044603685 8:94030965-94030987 ACAGAGGTCTGCATACACCTTGG + Intergenic
1045590584 8:103590383-103590405 TCAAAGATCTGCAGACACCTGGG - Intronic
1049066301 8:140318955-140318977 ACAGACATCAGCAGCCACCACGG - Intronic
1049420328 8:142513605-142513627 ACAGAGGTCTGCAGCCGCCCAGG + Intronic
1049581997 8:143417002-143417024 TCAGCCTTCTGCAGCCTCCTGGG - Intergenic
1051603273 9:18895502-18895524 ACACAGACCTGCAGACACCTGGG + Intronic
1051899880 9:22026256-22026278 ACAGAGATCTGAAAACTCCCTGG - Intronic
1052044761 9:23781588-23781610 ACAGCTCACTGCAGCCTCCTGGG + Intronic
1052094711 9:24369954-24369976 ACAGAGATTTGAAACCTCCATGG - Intergenic
1053161542 9:35816889-35816911 ACAGAGAACTGCAGCCTCTGGGG - Intronic
1053292291 9:36889160-36889182 CCACAGAGCTCCAGCCTCCTTGG + Intronic
1053472103 9:38354199-38354221 ACAGAGATCTCATGCCTCCCGGG - Intergenic
1054926927 9:70598947-70598969 TCAGAGATTTGCAGCATACTAGG - Intronic
1055157346 9:73080403-73080425 AGAGAGATCTGCAGACTCCCAGG - Intronic
1056495605 9:87151968-87151990 ACAAGGTTCTGGAGCCTCCTAGG + Intronic
1056895214 9:90540182-90540204 TCAGAGATGTGCAGCTTCCTTGG + Intergenic
1057399967 9:94714640-94714662 AGAGAGTTCTGCAGGCTCCCAGG + Intergenic
1058443716 9:105034664-105034686 AAAAATATCTGCAGCCTCCATGG - Intergenic
1058461772 9:105190007-105190029 ACAGAGATTTGAAACCTCCCTGG - Intergenic
1059284497 9:113161226-113161248 ACAGATTTGTGCAGCCTGCTGGG + Intronic
1059341017 9:113597614-113597636 ACAGAGATCTGGCACCCCCTGGG + Exonic
1059402011 9:114076505-114076527 GCAGAGATCTGCAACTTCCCAGG + Intronic
1059433727 9:114264521-114264543 AAAGAGCCCTGCAGCCTCCATGG - Intronic
1059740024 9:117141167-117141189 GCATAGGTCTGCAGCCTCCAAGG + Intronic
1060038999 9:120283646-120283668 CCAGAGATGTGCAGCTTCCTGGG + Intergenic
1060493188 9:124099851-124099873 ACAGGGTTCTGCCGTCTCCTGGG - Intergenic
1061537981 9:131261237-131261259 ACAGAGACCTGCACCATCGTGGG - Exonic
1061633110 9:131886086-131886108 ACAGAGCTCTGAAGTGTCCTGGG - Intronic
1061635431 9:131905424-131905446 ACAGAAAACAGCAGCTTCCTTGG - Intronic
1203438282 Un_GL000195v1:164224-164246 AGAGAGAGCTCCAGCTTCCTAGG + Intergenic
1185530846 X:817133-817155 ACAGACATCAACAGCCTCTTGGG - Intergenic
1187804034 X:23098481-23098503 ACAGAGATCTTTCACCTCCTTGG - Intergenic
1188835310 X:34947911-34947933 TCAGAGATGTGCATCCCCCTAGG + Intergenic
1189007948 X:37014676-37014698 TCAGAGATGTGCATCCCCCTAGG + Intergenic
1189040522 X:37537852-37537874 TCAGAGATGTGCATCCCCCTAGG - Intronic
1189200524 X:39191880-39191902 ACAGAGCTCTGCAGCCTTTTGGG - Intergenic
1189755222 X:44264437-44264459 CTTGAGATCTGCAGGCTCCTGGG - Intronic
1189943854 X:46156517-46156539 ACAGATATCTGCAGGCTACTTGG + Intergenic
1191095267 X:56666579-56666601 ACAGAGATTTCAAACCTCCTTGG - Intergenic
1192995743 X:76511318-76511340 GCAGAGATCTGTCACCTCCTTGG - Intergenic
1193236974 X:79119090-79119112 ACAGAGATCTTTCACCTCCTTGG + Intergenic
1193739795 X:85203522-85203544 ACAGAGATCTGAATTCTCCCTGG - Intergenic
1193877522 X:86879257-86879279 ATAGAGATCTTTCGCCTCCTTGG + Intergenic
1194030982 X:88814024-88814046 ATAGAGATCTTTAACCTCCTTGG - Intergenic
1194207800 X:91032606-91032628 ACAGATTCCTGCAGCATCCTAGG - Intergenic
1194211100 X:91070361-91070383 ACAGAGATCTTTCACCTCCTTGG - Intergenic
1194594098 X:95836536-95836558 ACAGAGATTTGAAGCCTCCCTGG - Intergenic
1195135352 X:101901012-101901034 ACAGAGATCTTTCGACTCCTTGG + Intronic
1195148543 X:102043081-102043103 ACAGAGGTTTCCAGCCTCCCTGG + Intergenic
1196152867 X:112393464-112393486 ACAAAGATTTGAAACCTCCTGGG - Intergenic
1196216360 X:113056666-113056688 ACAGAACTCTGGAGCCTCCAGGG + Intergenic
1196237330 X:113298638-113298660 ACACAGAATTGCAGCCTCTTGGG - Intergenic
1196582071 X:117391176-117391198 GCAGAGATTTGAAGCCTCCCTGG + Intergenic
1196717282 X:118823904-118823926 GCAAAGAACTGAAGCCTCCTTGG - Exonic
1197261906 X:124328753-124328775 TCATAGATCTGCAACCTACTTGG + Intronic
1200722027 Y:6618629-6618651 ACAGAGATTTGAAGCCTCCCTGG - Intergenic