ID: 905277387

View in Genome Browser
Species Human (GRCh38)
Location 1:36827309-36827331
Sequence AAATATCCACAGAAGCCCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 239
Summary {0: 1, 1: 1, 2: 2, 3: 27, 4: 208}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905277387_905277390 29 Left 905277387 1:36827309-36827331 CCCTGGGGCTTCTGTGGATATTT 0: 1
1: 1
2: 2
3: 27
4: 208
Right 905277390 1:36827361-36827383 TTCCCTTCCTCAAGTAGGAGAGG 0: 1
1: 0
2: 0
3: 11
4: 168
905277387_905277389 24 Left 905277387 1:36827309-36827331 CCCTGGGGCTTCTGTGGATATTT 0: 1
1: 1
2: 2
3: 27
4: 208
Right 905277389 1:36827356-36827378 ATCACTTCCCTTCCTCAAGTAGG 0: 1
1: 0
2: 2
3: 12
4: 374

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905277387 Original CRISPR AAATATCCACAGAAGCCCCA GGG (reversed) Intronic
901850262 1:12010594-12010616 AAAGCTCCACAGAGACCCCATGG - Intronic
904282618 1:29431838-29431860 AGAGATCAACAGAAGCCCCATGG - Intergenic
905277387 1:36827309-36827331 AAATATCCACAGAAGCCCCAGGG - Intronic
906459811 1:46028613-46028635 CAAGATCAACAGAAGCCCCAGGG - Intronic
907451520 1:54548520-54548542 CAATCTCCAAACAAGCCCCAGGG + Intronic
908854762 1:68413397-68413419 ACAAATCAACAGAAGCCCCATGG - Intergenic
913469467 1:119174457-119174479 AAAGGTCCACAAAAGCCCCCGGG + Intergenic
917118056 1:171622289-171622311 AAATCTCCACAGATGTCGCAGGG - Intergenic
917476408 1:175373065-175373087 AAACATGCACAGAAGCAGCATGG + Intronic
919344846 1:196362213-196362235 AACTCCTCACAGAAGCCCCAGGG - Intronic
919383447 1:196887679-196887701 AAACATCCACTGCAGCACCATGG + Intronic
919427635 1:197452546-197452568 AAATATTCACAGAAACCTTATGG + Intronic
921322490 1:213955458-213955480 AAATATCCAAAAAAGGCCGAGGG + Intergenic
922509401 1:226151056-226151078 AGATAGCCCCAGAGGCCCCAGGG + Intronic
923205389 1:231753889-231753911 AAAGATCCACAGATTCCCTAGGG + Intronic
924086536 1:240457534-240457556 AAATATACAGCGAAGCTCCAAGG + Intronic
1063516509 10:6701424-6701446 AAATATGCACAGAATGGCCATGG - Intergenic
1063982310 10:11463816-11463838 GAATATCCAAAGAAGCCCTTGGG - Exonic
1066521045 10:36219639-36219661 AAATATTCACTGAAGTCCTAAGG - Intergenic
1066555171 10:36604518-36604540 AAAGATCCCAAGAAGCCCCAGGG - Intergenic
1067896378 10:50184723-50184745 AAATAACCACTGAAGCACAAGGG - Exonic
1067952597 10:50757304-50757326 AAATAACCACTGAAGCACAAGGG + Intronic
1068937605 10:62651113-62651135 TAATACTCACAGAAGCCCTATGG - Intronic
1071437046 10:85657058-85657080 AAACAACCACAGAAACCCCAAGG - Intronic
1073067841 10:100774364-100774386 AAGGATCCACAGGAGACCCAAGG - Intronic
1073429480 10:103476890-103476912 AAAAATCCTCCAAAGCCCCAGGG - Intronic
1073504532 10:103973468-103973490 AAATGTACATAGAAGCCCTAAGG - Intronic
1073623669 10:105074600-105074622 CAATAACCATAGTAGCCCCAAGG - Intronic
1073968668 10:109021228-109021250 AAATTCCCATAGAATCCCCAAGG - Intergenic
1074698953 10:116076363-116076385 AAATTTCCACAGAAACACCCTGG + Intronic
1075523347 10:123159365-123159387 AAAAATGCAGAGAGGCCCCATGG - Intronic
1078030483 11:7746181-7746203 CAATGTCCACAGAAGCCAAATGG - Intergenic
1080058803 11:27934937-27934959 ACAAATCCACAGAAGCCGGAAGG + Intergenic
1080586075 11:33683795-33683817 AGATGTCCACAGTATCCCCAGGG + Intergenic
1080910479 11:36593050-36593072 AAACATCAACAGAAGATCCAGGG - Exonic
1080951289 11:37036138-37036160 AAATATCCATAAATGTCCCATGG + Intergenic
1081561953 11:44225927-44225949 TATTATCCACAGAAGGCTCATGG + Intronic
1082697967 11:56393920-56393942 AAAAATCCACAAAAGCCAGATGG - Intergenic
1083384407 11:62296885-62296907 AAATACCCATAGAAGCTGCAGGG - Intronic
1084279447 11:68077834-68077856 GAAAAGCCACAGCAGCCCCATGG + Intronic
1084499087 11:69524350-69524372 AACTCTCCGCAGAAGCCCCAGGG + Intergenic
1087156217 11:94907440-94907462 ATATACCCTCCGAAGCCCCAGGG - Intergenic
1088114235 11:106297820-106297842 AAATATCCAAACAAGCTACATGG - Intergenic
1088938178 11:114425757-114425779 CAATATTCACATAAGGCCCAAGG + Intronic
1088939156 11:114436181-114436203 AAATATTCACAATAGCCACAGGG + Intronic
1091490886 12:931631-931653 AAAGATCTTCAGAAACCCCAGGG + Intronic
1096078763 12:48820144-48820166 AATTAGCCCCAGAGGCCCCATGG - Intronic
1096807763 12:54150838-54150860 AAATTTCCACAGAAGCCCCACGG + Intergenic
1097940104 12:65294804-65294826 AAAAACCCACAGAAACCACATGG - Intronic
1098228331 12:68347713-68347735 AAAAATACACTGAAGACCCAAGG + Intergenic
1100090871 12:90969125-90969147 AAATATTCACAAAATCCACAAGG + Intronic
1101192535 12:102349880-102349902 AGTTATCCACACAAGCCCAATGG - Intergenic
1101714908 12:107302199-107302221 AAGTATCCAATGAAGCCCCAAGG - Intergenic
1101960726 12:109247765-109247787 AAATATCGCCACAAGCCCCGAGG - Intronic
1105633331 13:22193615-22193637 AAATGGCCACCCAAGCCCCATGG + Intergenic
1106157978 13:27174876-27174898 AAATATGCCCAGATGCCTCAGGG + Intergenic
1107190746 13:37582241-37582263 AAATATTCATAGAAGCATCAGGG - Intronic
1107763572 13:43708617-43708639 AATTTTCAACAGAAGCACCAAGG + Intronic
1108273299 13:48783858-48783880 AAATATCCACAAAAGGAGCAAGG + Intergenic
1108921044 13:55674661-55674683 AAATGTCCCCAAAGGCCCCACGG - Intergenic
1112495736 13:99902871-99902893 ACATACTCCCAGAAGCCCCAGGG + Intergenic
1115622978 14:35159031-35159053 AGAAATCCACAGAAGAACCACGG + Intronic
1116367116 14:44081335-44081357 AAATAACAACAGAATGCCCAGGG + Intergenic
1116928099 14:50661954-50661976 AAATTTCCACAGAACCAACAAGG - Intronic
1118013803 14:61637849-61637871 AAGAATCCACAGCAGCTCCAGGG - Intronic
1120531495 14:85637767-85637789 AGACATCCACAGAAGCGCAAAGG - Exonic
1121469872 14:94144491-94144513 ATATATCCAGAGGAGCCTCAAGG + Intergenic
1121524842 14:94612675-94612697 AAATGACCATAGAGGCCCCAGGG - Intronic
1121952645 14:98185084-98185106 AAAAAGCCACAGAAGGCCCTGGG + Intergenic
1123133208 14:106005194-106005216 AAATATTCACAGAAGTTCCAGGG - Intergenic
1123151355 14:106184998-106185020 AACTATGCACAGAAGCTCCAGGG - Intergenic
1123399760 15:19972881-19972903 AACTACCCACAGAAGCTCCAGGG - Intergenic
1123583233 15:21735607-21735629 AAATATTCACAGAAGCTCCAGGG - Intergenic
1123585026 15:21752375-21752397 ACATATGCACAGAAGTTCCAGGG - Intergenic
1123619883 15:22178204-22178226 AAATATTCACAGAAGCTCCAGGG - Intergenic
1123621673 15:22194982-22195004 ACATATGCACAGAAGTTCCAGGG - Intergenic
1123981162 15:25605494-25605516 GAAGTTCAACAGAAGCCCCATGG - Intergenic
1124035154 15:26047860-26047882 AAACACCCAAATAAGCCCCAAGG - Intergenic
1124620776 15:31272726-31272748 TAGTTTCCAAAGAAGCCCCAAGG + Intergenic
1131315545 15:91333656-91333678 GAATATACAGAGAAGCACCAGGG + Intergenic
1132072054 15:98787029-98787051 AAATATCCACAAGAGCGCCCTGG + Intronic
1133089192 16:3390306-3390328 AAATAACCCGAGAAGCCCCATGG + Intronic
1133570386 16:7034583-7034605 AAATATCCAGAGAAGATCCCTGG + Intronic
1134287503 16:12875015-12875037 CAATATCCCAAGGAGCCCCAGGG - Intergenic
1135660101 16:24288968-24288990 AACTGTCCTCAGAAGCCACATGG - Intronic
1139379931 16:66524226-66524248 AAAGGTCCAGTGAAGCCCCAAGG + Intronic
1140539836 16:75746848-75746870 AAATGTCCACAGAAACCCTTGGG + Intronic
1140546817 16:75817784-75817806 AAAAATCCACAAAAAACCCATGG + Intergenic
1140677295 16:77345022-77345044 AAATAACCACAGAGACTCCAAGG + Intronic
1143761635 17:9108484-9108506 AATAATCCACAGACACCCCATGG + Intronic
1143889848 17:10094434-10094456 AAATATCCAGAGAGTTCCCATGG - Intronic
1144861051 17:18302388-18302410 AAAAATCCTCTGAAGCCGCAGGG + Exonic
1145904180 17:28507317-28507339 AAATATCCAAAGAAGCCCGTTGG + Intronic
1147844473 17:43395153-43395175 CAGTATCAACAGAACCCCCAAGG + Intergenic
1149989338 17:61372698-61372720 AAGTATGCACAGAAGCCTCGCGG - Intronic
1154042093 18:10865907-10865929 AAATAACCACAAATACCCCATGG - Intronic
1158218802 18:55128826-55128848 AAATTTTCACAGAAGCTCCTTGG - Intergenic
1159033220 18:63252069-63252091 AAGTATGCAAAGAAGCCACAAGG + Intronic
1160057766 18:75501423-75501445 AAATAGCCACAGAAGTCCACTGG + Intergenic
1160094006 18:75854112-75854134 AAATAGCATCATAAGCCCCATGG + Intergenic
1160878493 19:1308869-1308891 AAAGAATCACAGAAGCCCCAGGG - Intergenic
1160883175 19:1331777-1331799 CAATTTCCACAGCTGCCCCAGGG - Intergenic
1161407033 19:4096403-4096425 AGAAACCCACAGAAGGCCCAGGG + Intronic
1161746446 19:6063205-6063227 AGATGTCCACACAACCCCCAAGG + Intronic
1161905062 19:7150398-7150420 AAAAAGCCACAGAAACCCCTGGG + Intronic
1164832532 19:31333570-31333592 AAACCACCAAAGAAGCCCCATGG + Intronic
1166336831 19:42113345-42113367 AAATATCCACACAGCCCCCTCGG + Intronic
925405653 2:3604117-3604139 AAGCTTCCACAGCAGCCCCAGGG - Intronic
925839028 2:7973549-7973571 ATATATCTACAGATGCCCCATGG - Intergenic
925894054 2:8457679-8457701 AAATAACCGAAGAAGCGCCAGGG + Intergenic
926715447 2:15920345-15920367 AAATATGTAAAGAAGCCACAGGG - Intergenic
926761136 2:16280147-16280169 AAATAGCCCCAGAATCCCTAAGG - Intergenic
927242547 2:20931402-20931424 AAATCTGGACAGAAGCCTCAGGG + Intergenic
931439124 2:62275162-62275184 AAATGTCCTCAGAACCCACAAGG - Intergenic
931738116 2:65216635-65216657 AAATATGTACAGAACACCCACGG - Intergenic
931968147 2:67556337-67556359 AAACATCATCAAAAGCCCCATGG + Intergenic
933526088 2:83441171-83441193 AAATAGCCACAGAAGTTCCAGGG - Intergenic
934047525 2:88185229-88185251 ACAGATCCACACAAACCCCAGGG - Intronic
934512035 2:94953256-94953278 ATATATGCACAGAAGTTCCAGGG - Intergenic
934616662 2:95775424-95775446 AGGTTTCCACAAAAGCCCCAAGG - Intergenic
934644228 2:96049135-96049157 AGGTTTCCACAAAAGCCCCAAGG + Intergenic
934789311 2:97044731-97044753 CAATTTCCACAGCAGCCACAGGG - Intergenic
934817168 2:97337810-97337832 CAATTTCCACAGCAGCCACAGGG + Intergenic
934820528 2:97370674-97370696 CAATTTCCACAGCAGCCACAGGG - Intergenic
934837643 2:97605225-97605247 AGGTTTCCACAAAAGCCCCAAGG + Intergenic
938034112 2:128021640-128021662 AAATATCCTCAGCAACACCAAGG + Intronic
942204587 2:173607572-173607594 AAAAATACTTAGAAGCCCCAGGG + Intergenic
943726344 2:191255518-191255540 AAAGAGGCTCAGAAGCCCCAAGG + Intronic
944291426 2:198010751-198010773 AATTATTCAGAGAAGCCACATGG + Intronic
946208991 2:218132037-218132059 AAATAACAACAAAAGTCCCAGGG - Intronic
946706464 2:222463218-222463240 ACATATCCACAGTCACCCCAGGG + Intronic
947809860 2:232997509-232997531 AAATCTCCACTGTAGGCCCAAGG - Intronic
1168797899 20:623800-623822 AAATATACACAAAAGGCACAGGG - Intergenic
1169892607 20:10469964-10469986 AACTATCCAAAGTGGCCCCAGGG + Intronic
1170206276 20:13802190-13802212 AAATCTCGAAAGAAGACCCATGG + Intronic
1170420827 20:16191353-16191375 ACATATACACACAAGGCCCATGG - Intergenic
1170421691 20:16199750-16199772 GAATGTTCACGGAAGCCCCAAGG + Intergenic
1171421411 20:25020301-25020323 AAAGATGGAAAGAAGCCCCATGG + Intronic
1172876367 20:38166721-38166743 AAATATCCACTGAAGCAACACGG - Intergenic
1173008595 20:39160210-39160232 AAGTACCTACAGAAGCCCCAAGG + Intergenic
1173392368 20:42646527-42646549 AAATATCCACATATGGCCAATGG - Intronic
1175649465 20:60705894-60705916 AAATCTGCACATAAGCACCATGG - Intergenic
1178267580 21:31158294-31158316 AAATGTCCAAAGAGGACCCAAGG - Intronic
1183491919 22:38121367-38121389 CAAAAACCACTGAAGCCCCACGG + Intronic
1183663300 22:39233920-39233942 AGAAATTCCCAGAAGCCCCAGGG + Intronic
1184304035 22:43582927-43582949 AAAGATTCATAGATGCCCCAAGG + Intronic
950921807 3:16702508-16702530 AAATATCTAGAGGAGCACCAAGG + Intergenic
951184453 3:19696370-19696392 AAATATCCAAAGCAATCCCAAGG + Intergenic
953250479 3:41242151-41242173 AAATATCCACAGATGGAGCAAGG + Intronic
954654259 3:52184352-52184374 AAATAGACTCAGAAGCCCGAAGG + Intergenic
956503356 3:69910845-69910867 AAAAATCCACAGAAGGGACAAGG - Intronic
958937702 3:100274955-100274977 CATTATCCACAGTAGCCCAAAGG - Intronic
962118446 3:132536428-132536450 AAATATCCAGCAATGCCCCAGGG + Intronic
963226056 3:142862735-142862757 AAATATCCAGAGAACTCCAAAGG + Intronic
963926538 3:150957292-150957314 AAATAGCCACAGGATCCCTAAGG - Intronic
964082839 3:152781114-152781136 AAATATCCACTAAAGGCCTAGGG + Intergenic
964116457 3:153140944-153140966 AAAGATCAATAGAAGCCACAGGG + Intergenic
966078819 3:175974861-175974883 ATATATGCAGAGCAGCCCCAAGG + Intergenic
966538105 3:181056770-181056792 AAATACCTTCATAAGCCCCAAGG - Intergenic
967270295 3:187727261-187727283 ATTTATACACAGAAGCCCTAGGG + Intronic
967456445 3:189691795-189691817 AAATAACAACAGAAACCCAAAGG - Intronic
968211214 3:196850464-196850486 AAATGTACACAGGAGCTCCAGGG + Intergenic
970302874 4:14700161-14700183 AAATATCAACACAAGCCACTGGG - Intergenic
970689606 4:18607340-18607362 ATATATCCACATATTCCCCATGG - Intergenic
971177558 4:24294207-24294229 AAATTTTCACAAAAGCCCCAGGG - Intergenic
971467625 4:26981029-26981051 TAATACCTACAGAAACCCCAAGG + Intronic
972422859 4:38905900-38905922 AAATATCAAAAGAAGGCCCTGGG - Intronic
973273815 4:48288154-48288176 AAATCTCTACAGAAGGCCCAAGG + Intergenic
974498790 4:62669555-62669577 AAATATTCATAGAAGACCCCGGG - Intergenic
976257368 4:83112416-83112438 TAATATTCACAGAAGCACCTGGG - Intronic
977480955 4:97574736-97574758 AAAAATCCACAGAAGCAGAAAGG - Intronic
977563549 4:98558501-98558523 TAATATCCACAGCTTCCCCAGGG + Intronic
978300587 4:107265494-107265516 AAATAACCACAGGGGACCCAGGG - Intronic
979561484 4:122106863-122106885 AAATATCTGCAGAGGCCACAAGG - Intergenic
982421410 4:155202891-155202913 AAACATGCACAGAAGACCCATGG - Intergenic
983392621 4:167152041-167152063 AAATATGTAATGAAGCCCCAAGG + Intronic
985358828 4:189150066-189150088 AAATATCCACAGTATCATCATGG + Intergenic
986124518 5:4872951-4872973 ATATTTACACAGAAGCACCAGGG - Intergenic
986624424 5:9710097-9710119 ACATTTCCACAGAACACCCAAGG + Intronic
986981602 5:13454146-13454168 AAAAATCCACTGAAGCCCAGGGG - Intergenic
989435951 5:41413976-41413998 AAATATCATCAGAACCTCCAAGG - Intronic
989621815 5:43391972-43391994 AAATTCTCACACAAGCCCCAAGG - Intronic
990227883 5:53676775-53676797 AAATGACCACAGAAGCACCATGG + Intronic
996000079 5:118350664-118350686 AAATTTCCACCTAAGCCTCATGG + Intergenic
996239369 5:121176220-121176242 AAATATCTACAGAAGCCAACAGG - Intergenic
996833539 5:127766501-127766523 TAGAATCCACAGAAGTCCCATGG - Intergenic
999451728 5:151683353-151683375 ACTTATGCACACAAGCCCCATGG - Intronic
999910764 5:156196060-156196082 GAATCTCCAAGGAAGCCCCAAGG - Intronic
1001731397 5:173963106-173963128 AAATATCCTGAGAAGACTCAAGG - Intergenic
1003642970 6:7891088-7891110 AAATATCCAGTGTAGCTCCAGGG - Intronic
1004320761 6:14629910-14629932 AAAAAGCCACAGAAGCACAAGGG + Intergenic
1004717889 6:18235954-18235976 AAATTTCCATAGAATCCCTATGG + Intronic
1007253568 6:40512888-40512910 AAATATACAGAGAACCTCCAGGG + Intronic
1010713672 6:79204507-79204529 AAATATCCACAGAAAACTCCTGG - Intronic
1011506415 6:88048579-88048601 AAAACTGCCCAGAAGCCCCATGG + Intronic
1016015851 6:139185169-139185191 AAATATGCACAGTAGCCCCCAGG - Intergenic
1018219858 6:161566906-161566928 AGGTATCCAGAGAAGCCTCATGG - Intronic
1018388818 6:163327807-163327829 CAATCTCCACAGAGGGCCCAGGG - Intergenic
1018940864 6:168308244-168308266 AAAAATCAAGAGAAGTCCCATGG - Exonic
1021782438 7:24119197-24119219 AAATGTCCACAGAAGCCAGAAGG - Intergenic
1022030021 7:26484029-26484051 CAAGATCCACAAAATCCCCAAGG - Intergenic
1022545901 7:31188703-31188725 AGAGATCACCAGAAGCCCCAGGG + Intergenic
1022986198 7:35656609-35656631 AAATAGACACAGAAGACCAATGG + Intronic
1022991049 7:35707540-35707562 AAAAAGCCACAGAAGCATCATGG + Intergenic
1023444104 7:40214394-40214416 TAATATTTACAGCAGCCCCATGG + Intronic
1027052730 7:75029999-75030021 AAATAACGAAAGAGGCCCCAGGG + Intronic
1027246992 7:76374166-76374188 CAAGATCCACAGAAACCCCTGGG + Intergenic
1029018595 7:97340344-97340366 AAAGATACACAGAAGCCTCTGGG - Intergenic
1029213864 7:98930994-98931016 AGATACCCACAGAAGGCCTATGG - Intronic
1030681048 7:112434227-112434249 AACTATACACAGCAGCCCCACGG - Intronic
1030968462 7:116023748-116023770 AAAAATCCACAGCACTCCCAGGG + Intronic
1032743076 7:134759034-134759056 AAAGATCCACAGACTCTCCAAGG - Intronic
1033980516 7:147158976-147158998 AAATAACCACTGAATCCTCAGGG - Intronic
1035612918 8:980249-980271 AAATATCCATAGAAGGTGCAGGG + Intergenic
1035919149 8:3657889-3657911 AAATTTGCACAGAAGCTCCAGGG - Intronic
1035934876 8:3825717-3825739 AAATTTCCACTGAAGCAACAAGG + Intronic
1041564636 8:59262601-59262623 AATTATGCACAAAAGCTCCAAGG - Intergenic
1042669906 8:71250058-71250080 AAATATCCACAAAAGACACAAGG - Intronic
1043715011 8:83471772-83471794 AAAAATACACAGAAGACCAAGGG + Intergenic
1045340320 8:101248664-101248686 AAACATCAATAGAAGCCCCAGGG - Intergenic
1046528830 8:115417772-115417794 AAATACCCACTGAAGGCCCTGGG + Intronic
1047567187 8:126058206-126058228 AAATATACACATAAGTTCCAGGG - Intergenic
1048275547 8:133063037-133063059 AACTTTCCCCAGAAGCCCAAAGG - Intronic
1048778992 8:137980435-137980457 AAAAATACACAGAAGCCAAAAGG - Intergenic
1049548075 8:143243888-143243910 AAATATGGAAAGAAGCTCCAAGG - Intergenic
1059885010 9:118736198-118736220 AAATTTTCACAGAAACCCTAGGG - Intergenic
1060270604 9:122138022-122138044 AAACAACCACAGCAGCCCAAGGG + Intergenic
1061189937 9:129076532-129076554 GAATATGGCCAGAAGCCCCAGGG - Intergenic
1061369091 9:130187839-130187861 AATTGTTCACAGAAGCCACACGG - Intronic
1190167168 X:48082843-48082865 TAATTCCCAGAGAAGCCCCAGGG - Intergenic
1192307043 X:69972345-69972367 AAAAATCTACAGAACCCCAAGGG - Intronic
1194738160 X:97539306-97539328 AGGTCTCCACAGAAGGCCCAAGG + Intronic
1194968368 X:100315610-100315632 AAATATGCTTAGAAGTCCCATGG + Intronic
1196814801 X:119656531-119656553 AATTATTCACAGTAGCCCAAAGG + Intronic
1197378646 X:125712097-125712119 AAATATCCACAAACTTCCCAAGG + Intergenic
1201052635 Y:9953732-9953754 AAATAACAAAAGAAGTCCCAAGG + Intergenic
1202240864 Y:22767611-22767633 AAATAACAAAAGAAGTCCCAAGG - Intergenic
1202393850 Y:24401354-24401376 AAATAACAAAAGAAGTCCCAAGG - Intergenic
1202476935 Y:25268738-25268760 AAATAACAAAAGAAGTCCCAAGG + Intergenic