ID: 905278712 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 1:36835516-36835538 |
| Sequence | ATGTGGAGAAGGAAGGAGGA AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 2136 | |||
| Summary | {0: 1, 1: 1, 2: 23, 3: 217, 4: 1894} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 905278712_905278716 | -10 | Left | 905278712 | 1:36835516-36835538 | CCTTCCTCCTTCCTTCTCCACAT | 0: 1 1: 1 2: 23 3: 217 4: 1894 |
||
| Right | 905278716 | 1:36835529-36835551 | TTCTCCACATCCCTTGCCCTTGG | 0: 1 1: 0 2: 1 3: 36 4: 309 |
||||
| 905278712_905278722 | 8 | Left | 905278712 | 1:36835516-36835538 | CCTTCCTCCTTCCTTCTCCACAT | 0: 1 1: 1 2: 23 3: 217 4: 1894 |
||
| Right | 905278722 | 1:36835547-36835569 | CTTGGCACTCATTCTTTCCCTGG | 0: 1 1: 0 2: 2 3: 21 4: 207 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 905278712 | Original CRISPR | ATGTGGAGAAGGAAGGAGGA AGG (reversed) | Intronic | ||
| Too many off-targets to display for this crispr | |||||