ID: 905278712

View in Genome Browser
Species Human (GRCh38)
Location 1:36835516-36835538
Sequence ATGTGGAGAAGGAAGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2136
Summary {0: 1, 1: 1, 2: 23, 3: 217, 4: 1894}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905278712_905278716 -10 Left 905278712 1:36835516-36835538 CCTTCCTCCTTCCTTCTCCACAT 0: 1
1: 1
2: 23
3: 217
4: 1894
Right 905278716 1:36835529-36835551 TTCTCCACATCCCTTGCCCTTGG 0: 1
1: 0
2: 1
3: 36
4: 309
905278712_905278722 8 Left 905278712 1:36835516-36835538 CCTTCCTCCTTCCTTCTCCACAT 0: 1
1: 1
2: 23
3: 217
4: 1894
Right 905278722 1:36835547-36835569 CTTGGCACTCATTCTTTCCCTGG 0: 1
1: 0
2: 2
3: 21
4: 207

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905278712 Original CRISPR ATGTGGAGAAGGAAGGAGGA AGG (reversed) Intronic
Too many off-targets to display for this crispr