ID: 905279716

View in Genome Browser
Species Human (GRCh38)
Location 1:36841372-36841394
Sequence CCCATAGCTGGGGCATCCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 519
Summary {0: 1, 1: 0, 2: 2, 3: 42, 4: 474}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905279707_905279716 15 Left 905279707 1:36841334-36841356 CCAAGAATTTGGTGAAGTGTCTC 0: 1
1: 0
2: 0
3: 15
4: 148
Right 905279716 1:36841372-36841394 CCCATAGCTGGGGCATCCTCTGG 0: 1
1: 0
2: 2
3: 42
4: 474

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905279716 Original CRISPR CCCATAGCTGGGGCATCCTC TGG Intronic
900644646 1:3703381-3703403 CCCTTAGCAGGGCCTTCCTCAGG - Intronic
900830920 1:4964837-4964859 CCCAGAGCTGGTGCTTCCTCAGG + Intergenic
901052570 1:6432627-6432649 CACACTGCTGGGGCATCCTAGGG + Intronic
901312674 1:8281628-8281650 CACATGGCTGGGGAGTCCTCAGG - Intergenic
901735713 1:11310897-11310919 CCCTTACCTGGAGCCTCCTCTGG - Intergenic
901911220 1:12459884-12459906 CCCAGAGCTTGGGCAGCCTACGG - Intronic
902631046 1:17704844-17704866 CCCATGGCTGGGGAGGCCTCAGG - Intergenic
904317658 1:29676237-29676259 CCCATTGATGGGACATCCTCGGG - Intergenic
904772961 1:32891124-32891146 CCCATTCCCTGGGCATCCTCAGG + Intronic
904880697 1:33694628-33694650 CTCATGGCTGGGGAAGCCTCAGG - Intronic
905279716 1:36841372-36841394 CCCATAGCTGGGGCATCCTCTGG + Intronic
907985263 1:59524118-59524140 CCCATTGCTGGTGCCTGCTCTGG + Intronic
908422900 1:63976966-63976988 CGCATATCTGGGGAAGCCTCAGG + Intronic
909067122 1:70948422-70948444 CACAGAGCTGGGGAAACCTCAGG - Intronic
910237961 1:85055042-85055064 CACATAGCTGGGGAGGCCTCAGG - Intronic
910301770 1:85714034-85714056 CCCATATATGTGGCATCTTCAGG + Intergenic
911061350 1:93750853-93750875 ACGATATCTGGGGCATCATCTGG - Intronic
911596673 1:99805709-99805731 CACATGGCTGGGGAAGCCTCAGG + Intergenic
912551594 1:110488667-110488689 CCCACAGCTGGATCAGCCTCTGG - Intergenic
913489318 1:119364168-119364190 CACATGGCTGGGGAGTCCTCAGG + Intergenic
916335337 1:163664803-163664825 GCCAGAGCTGGGGCAGCCCCAGG - Intergenic
916962638 1:169904711-169904733 AGCATGGCTGGGGCATCCTCAGG - Intergenic
917095981 1:171399283-171399305 CACATGGCTGAGGCAGCCTCAGG + Intergenic
919844050 1:201629723-201629745 CCCATAGCCTGGGCATCCCCTGG - Intronic
921669785 1:217912826-217912848 CACATGGCTGGGGAAGCCTCAGG - Intergenic
921770983 1:219039591-219039613 CACATGGCTGGGGAAGCCTCAGG - Intergenic
922135292 1:222819228-222819250 AGCATAGCTGGGGAAGCCTCAGG - Intergenic
922683327 1:227618910-227618932 CCCATGGCTGGGGGGGCCTCAGG + Intronic
923788339 1:237089970-237089992 CACATGGCTGGGGAAGCCTCAGG + Intronic
923961628 1:239091034-239091056 CACATGGCTGGGGAAGCCTCAGG - Intergenic
924936891 1:248779416-248779438 CACATTGCTGGGGAAGCCTCAGG + Intergenic
1063078553 10:2741776-2741798 CACATGGCTGGGGAAGCCTCAGG - Intergenic
1063618047 10:7619586-7619608 CGCATGGCTGGGGAAGCCTCGGG + Intronic
1063717350 10:8541246-8541268 CCCATGGCTGGGGAGGCCTCAGG + Intergenic
1063729113 10:8676009-8676031 CACATAGCTGGGGAGCCCTCAGG + Intergenic
1064246067 10:13668618-13668640 CACATGGCTAGGGCATTCTCAGG + Intronic
1065733138 10:28727616-28727638 CCCATGGCTGGGGAAGCCTTAGG - Intergenic
1067029121 10:42868577-42868599 GCCATTGCTGGGGCCTCCCCTGG + Intergenic
1067442628 10:46318143-46318165 CCCACTGCTGAGGGATCCTCCGG - Intronic
1068008838 10:51422326-51422348 CACCTAGCTGTGGCATCCTATGG - Intronic
1068452506 10:57210983-57211005 CACATAGCTGGGGAAGCCTCAGG + Intergenic
1068762893 10:60733003-60733025 CCCAGTGCTGGAGCATCCCCAGG - Intronic
1071126296 10:82339346-82339368 CACATAGCTGGGGAGTCCTCAGG + Intronic
1073325419 10:102642203-102642225 CCAATAGCAGGAGCAGCCTCCGG + Intergenic
1073473008 10:103735553-103735575 CCCGTAGCTGGGCCACCCTCTGG - Intronic
1073538883 10:104302017-104302039 CACATGGCTGGGGAAGCCTCAGG + Intronic
1073859520 10:107721652-107721674 CGCATAGCTGGGGAAGCTTCAGG - Intergenic
1073880179 10:107972434-107972456 TCCATGGCTGGGGAAGCCTCAGG - Intergenic
1073943211 10:108721340-108721362 AGCATAGCTGGGGAGTCCTCAGG + Intergenic
1074205788 10:111281649-111281671 CCCAGATCTGGGGCAGCCTGAGG - Intergenic
1074446445 10:113524987-113525009 CCCAGAGATGAGTCATCCTCAGG + Intergenic
1075515919 10:123108101-123108123 CCCATGGCTGGGGAGGCCTCAGG - Intergenic
1075670581 10:124261518-124261540 CGCATGGCTGGGGAAGCCTCAGG + Intergenic
1076210364 10:128636756-128636778 AGCATAGCTGGGGAAGCCTCAGG - Intergenic
1077787364 11:5398833-5398855 CACATAGCTGGGGAGGCCTCAGG - Intronic
1079373253 11:19870167-19870189 CCCAGGGCTGGGGAATCTTCTGG - Intronic
1080400171 11:31927148-31927170 CACATAGCTGGGGAAGCCTCAGG - Intronic
1081045773 11:38271213-38271235 CACATAGCTGGGGAGGCCTCAGG + Intergenic
1081737771 11:45416178-45416200 CACATGGCTGGGGAAGCCTCAGG - Intergenic
1083136239 11:60679209-60679231 CACATGGCTGGGGAAGCCTCAGG + Intergenic
1083688196 11:64390345-64390367 CCCAGAGCTGGGGAGGCCTCAGG + Intergenic
1084444549 11:69196100-69196122 CCCATAGCGGGGCCTTCCACCGG - Intergenic
1084453866 11:69256205-69256227 CCCATGGCTGGGGAGGCCTCAGG + Intergenic
1085404552 11:76254273-76254295 GCCAGAGCTGGGGCAGGCTCTGG + Intergenic
1085920909 11:80955920-80955942 CACATGGCTGGGGAAGCCTCAGG - Intergenic
1086123791 11:83328600-83328622 CACATGGCTGGGGAAGCCTCAGG - Intergenic
1087093369 11:94298010-94298032 CGCATGGCTGGGGAAGCCTCAGG - Intergenic
1089375792 11:117993684-117993706 CCCATAACAGGGGCGCCCTCTGG - Intronic
1092882968 12:12902109-12902131 CCCTTACCTGGGTCATTCTCTGG + Intronic
1093954282 12:25198186-25198208 CCCTGGACTGGGGCATCCTCAGG + Intronic
1094601262 12:31911102-31911124 GCCATACCTAGGACATCCTCAGG + Intergenic
1094693002 12:32788044-32788066 CACATGGCTGGGGGAGCCTCAGG + Intergenic
1095407121 12:41879230-41879252 CGCATTGCTGGGGAAGCCTCAGG + Intergenic
1095731393 12:45510576-45510598 CACATGGCTGGGGAAGCCTCAGG + Intergenic
1095836645 12:46647175-46647197 CGCATAGCTGGGGAGGCCTCAGG + Intergenic
1096065842 12:48739570-48739592 CGCATAGCCGGGGAAGCCTCAGG + Intergenic
1097302869 12:58036809-58036831 CACATAGCTGGGGAGGCCTCAGG + Intergenic
1098030499 12:66248726-66248748 CCCTTAGCTACGGCATGCTCTGG + Exonic
1098616916 12:72537515-72537537 CACATGGCTGGGGAAGCCTCAGG - Intronic
1098713811 12:73802371-73802393 CACATAGCTGGGGAGGCCTCAGG - Intergenic
1098921090 12:76302852-76302874 CACATAGCTGGGGAGGCCTCAGG - Intergenic
1099621165 12:85004492-85004514 CACATGGCTGGGGAAGCCTCAGG - Intergenic
1100123553 12:91396197-91396219 CACATAGCTGGGGATGCCTCAGG - Intergenic
1100725181 12:97400845-97400867 CACATGGCTGGGGAAGCCTCAGG + Intergenic
1101309230 12:103561236-103561258 CACAAAGCTGGGGCTTGCTCTGG - Intergenic
1103263653 12:119610711-119610733 CACATGGCTGGGGAAGCCTCAGG - Intronic
1104130014 12:125884428-125884450 CACATGGCTGGGGAAGCCTCAGG - Intergenic
1105227248 13:18447575-18447597 CTCATAGCTGGGGAGGCCTCAGG - Intergenic
1107656069 13:42592933-42592955 CGCATGGCTGGGGAAGCCTCAGG - Intronic
1108504767 13:51102793-51102815 CACATGGCTGGGGAAGCCTCAGG + Intergenic
1108851849 13:54739595-54739617 CACATAGTTGGGGAAGCCTCAGG - Intergenic
1109474478 13:62861320-62861342 CTCATGGCTGGGGCGGCCTCAGG + Intergenic
1110831238 13:80033618-80033640 CACACAGCTGGGGAAGCCTCAGG - Intergenic
1110946937 13:81433761-81433783 CTCATGGCTGGGGAAGCCTCAGG + Intergenic
1111019801 13:82434727-82434749 CGCATGGCTGGGGAGTCCTCAGG + Intergenic
1111108193 13:83673464-83673486 CCCAAAGCTGGTGGATTCTCCGG - Intergenic
1111175854 13:84595623-84595645 CACATGGCTGGGGAAACCTCAGG - Intergenic
1111827483 13:93286118-93286140 CACATAGCTGGGGAGGCCTCAGG + Intronic
1111909389 13:94293475-94293497 CCCATGGCTGGGGAGGCCTCAGG - Intronic
1111918238 13:94383806-94383828 CCTATAGCTGGGGAGGCCTCAGG + Intronic
1112265507 13:97919936-97919958 CTCATGGCTGGGGCTCCCTCTGG + Intergenic
1113100058 13:106707501-106707523 CACATTGCTGGGGAAGCCTCAGG + Intergenic
1113549828 13:111184233-111184255 CACATAGCTGGGGAGGCCTCAGG - Intronic
1113896573 13:113768441-113768463 CCCAGAGCTGGGGCTTCCTGTGG + Intronic
1114011699 14:18376029-18376051 CTCATAGCTGGGGAGGCCTCAGG - Intergenic
1115402577 14:32978969-32978991 CCCATATCTGGGACATCGTAAGG + Intronic
1116098052 14:40397053-40397075 CCCATGGCTGGGGAGGCCTCAGG - Intergenic
1116281036 14:42908062-42908084 CACATGGCTGGGGAAGCCTCGGG + Intergenic
1116712914 14:48391918-48391940 CACATGGCTGGGGAAGCCTCAGG + Intergenic
1117207062 14:53453879-53453901 CACATAGCTGGGGAGGCCTCAGG - Intergenic
1117793108 14:59361771-59361793 GCCATAGCTTGGGCCTGCTCTGG + Intronic
1119174052 14:72556224-72556246 CACATGGCTGGGGAAGCCTCAGG + Intronic
1119979043 14:79058926-79058948 CACATGGCTGGGGAAGCCTCAGG - Intronic
1120225994 14:81791327-81791349 CACATGGCTGGGGAAGCCTCAGG - Intergenic
1120446155 14:84598676-84598698 CACATGGCTGGGGAAGCCTCAGG - Intergenic
1120659380 14:87234152-87234174 CTCATTGCTGGGGAAGCCTCAGG - Intergenic
1120984293 14:90320248-90320270 CACATAGCTGGGGAGGCCTCAGG + Intronic
1121043285 14:90768279-90768301 CACATAGCTGGGGAGACCTCAGG + Intronic
1121814090 14:96915768-96915790 CACACAGCTGGGGAAGCCTCAGG - Intronic
1121870094 14:97399521-97399543 CACATAGCTGGGGAGGCCTCAGG + Intergenic
1121877600 14:97467785-97467807 GGCATAGCTGGGGAGTCCTCAGG + Intergenic
1122004969 14:98695490-98695512 CGCATAGCTGGGGAGGCCTCAGG + Intergenic
1122858318 14:104570742-104570764 CCCATAGCTGTGTCATGCCCAGG - Intronic
1122885553 14:104708878-104708900 CCCCTAGCTGGGGCAGCATGGGG - Intronic
1202844821 14_GL000009v2_random:159051-159073 CCCAAATCTTGGTCATCCTCAGG - Intergenic
1202914221 14_GL000194v1_random:149298-149320 CCCAAATCTTGGTCATCCTCAGG - Intergenic
1123735570 15:23179976-23179998 CCCATAGCCGCGCCAGCCTCGGG - Intergenic
1124286286 15:28402959-28402981 CCCATAGCCGCGCCAGCCTCGGG - Intergenic
1124296417 15:28508677-28508699 CCCATAGCCGCGCCAGCCTCGGG + Intergenic
1124653135 15:31487386-31487408 GCTATGGCTGGGGCATCCTGGGG - Intronic
1125230915 15:37453802-37453824 CACATGGCTGGGGAATCCTCAGG - Intergenic
1125420918 15:39503267-39503289 CACATGGCTGGGGAGTCCTCAGG + Intergenic
1125854082 15:42932456-42932478 CACATTGCTGGGGAAGCCTCAGG - Intergenic
1126127924 15:45313179-45313201 AGCATAGCTGGGGAAGCCTCAGG - Intergenic
1126272934 15:46843913-46843935 CACATGGCTGGGGAGTCCTCAGG + Intergenic
1126494850 15:49278872-49278894 CACATTGCTGGGGCAGCCTCAGG + Intronic
1127543290 15:59964858-59964880 CACATAGCTGGGGAGGCCTCAGG - Intergenic
1127872206 15:63083075-63083097 CCTATAGCTGAGGAGTCCTCGGG + Intergenic
1128059851 15:64728428-64728450 CCCAGAGCTGGTTCTTCCTCAGG + Intergenic
1128514899 15:68335927-68335949 CCCATCACTGGCCCATCCTCTGG - Intronic
1130216389 15:81974385-81974407 CTCACAGCTGGGGAAGCCTCAGG + Intergenic
1130258370 15:82336386-82336408 GCCATAGCTGGGGCCTGCTTGGG - Intergenic
1130562409 15:84968933-84968955 TCCTGAGCTGGGGCACCCTCTGG + Intergenic
1130596555 15:85253574-85253596 GCCATAGCTGGGGCCTGCTCGGG + Intergenic
1132348589 15:101123111-101123133 CCCAAAGCTGGTGCTACCTCAGG - Intergenic
1132728896 16:1351060-1351082 CCCTTAGCTAGGCCATTCTCCGG - Intronic
1133367946 16:5225906-5225928 CCCTTTGCTGGGGAATCCTTGGG + Intergenic
1133665865 16:7967110-7967132 CACATGGCTGGGGAAGCCTCAGG + Intergenic
1134606284 16:15573816-15573838 GGCATAGCTGGGGAAGCCTCAGG + Intronic
1134606315 16:15574080-15574102 GGCATAGCTGGGGAAGCCTCAGG + Intronic
1134937682 16:18260163-18260185 AGCATAGCTGGGGAAGCCTCAGG - Intergenic
1135168918 16:20165794-20165816 CACATGGCTGGGGAAGCCTCAGG + Intergenic
1135680967 16:24456267-24456289 CACATAACTGGGGCGGCCTCAGG - Intergenic
1135780908 16:25299765-25299787 CACATGGCTGGGGAAGCCTCAGG - Intergenic
1135889418 16:26343776-26343798 CACATAGCTGGGGAGGCCTCAGG - Intergenic
1137252351 16:46749347-46749369 CCCATGGCTGGACCATCCTCAGG - Intronic
1138422641 16:56909575-56909597 CCAATAGCTGGGGCCTCTTTGGG - Intronic
1139621774 16:68150948-68150970 CCCATGGCTGGGGGGGCCTCAGG - Intronic
1140355898 16:74306202-74306224 CCCATAGCTCTGGCATCCTCAGG + Exonic
1140492970 16:75355824-75355846 CGCATAGCTGGGGAAGCCTCAGG - Intronic
1142123709 16:88399886-88399908 CCCAGGGCTGGGGCCACCTCAGG + Intergenic
1142339072 16:89508720-89508742 TCCACAGCTGGGGGATCCGCGGG - Intronic
1143705634 17:8696125-8696147 CCCCAACCTGGGGCATTCTCCGG - Intergenic
1145911494 17:28546055-28546077 CCCAGAGCTGACGCACCCTCTGG - Intronic
1146257071 17:31397760-31397782 GTCCTAGCTGGGGCACCCTCTGG + Intronic
1146936523 17:36815658-36815680 TCCTAAGCTGGGGCATCCTCCGG + Intergenic
1147518295 17:41142990-41143012 ACCATGGCTGGGGAAGCCTCAGG + Intergenic
1147892176 17:43725127-43725149 CACATGGCTGGGGAAGCCTCAGG + Intergenic
1147931316 17:43983395-43983417 CCCAGAGCTGGGGCTCCATCAGG - Intronic
1149222508 17:54431845-54431867 CACATGGCTGGGGAAACCTCAGG + Intergenic
1150459164 17:65332880-65332902 CCCATGGCTGGGGAGGCCTCAGG + Intergenic
1151183240 17:72344802-72344824 CACATGGCTGGGGCGACCTCAGG + Intergenic
1151467395 17:74296034-74296056 CCCAGAGCTGTGTCATGCTCAGG - Intronic
1152564985 17:81096371-81096393 CCCTTAAGTGGGGCAGCCTCAGG - Intronic
1153887407 18:9478875-9478897 CCCAGAGCTGGGGTGTCCTGGGG + Intronic
1155681501 18:28492206-28492228 CGCATTGCTGGGGAAGCCTCAGG - Intergenic
1156890711 18:42186735-42186757 CGCATGGCTGGGGAAGCCTCAGG - Intergenic
1157210518 18:45738197-45738219 GCCAAAGCTGGGGCTCCCTCTGG + Intronic
1157306437 18:46520979-46521001 CTCATCACTGGGGCATCCGCAGG - Intronic
1157952436 18:52054603-52054625 TCCATAGCTAAGCCATCCTCTGG - Intergenic
1158595773 18:58814566-58814588 CCCATGGCTGGGGAAGCCTCAGG - Intergenic
1158751803 18:60270788-60270810 CCTATAGCAGTGGCATCCTCTGG + Intergenic
1159064504 18:63555035-63555057 CGCATGGCTGGGGAAGCCTCAGG - Intergenic
1159357914 18:67359837-67359859 CACATTGCTGGGGAAGCCTCAGG - Intergenic
1159436840 18:68429202-68429224 CACATTGCTGGGGAAGCCTCAGG + Intergenic
1159454668 18:68645264-68645286 CACATGGCTGGGGAAGCCTCAGG - Intergenic
1160119888 18:76120874-76120896 CACATGGCTGGGGAAGCCTCAGG - Intergenic
1160822807 19:1066320-1066342 CCAAGAGCTGGGGCATCTGCAGG - Intronic
1161083747 19:2324261-2324283 CCCATACCTGGGCCATGCTGGGG - Intronic
1161503617 19:4631958-4631980 CTCATGGCTGGGGAAGCCTCAGG + Intergenic
1161851268 19:6739293-6739315 CCCATTGCAGGGGCAACCTGAGG - Intronic
1162306784 19:9879546-9879568 ACCATAGCTGGGGAGGCCTCAGG - Intronic
1162322334 19:9977554-9977576 CCCATTCCTAGGGCCTCCTCAGG - Intronic
1164234498 19:23320448-23320470 CACATAGCTGGGGAGACCTCAGG + Intronic
1164302734 19:23976101-23976123 CACATAGCTGGGGAGACCTCAGG - Intergenic
1164784820 19:30921726-30921748 CCCATGGCTTGCCCATCCTCTGG + Intergenic
1165026056 19:32962334-32962356 TGCATGGCTGGGGAATCCTCAGG - Intronic
1166270182 19:41708754-41708776 CCCACAGATGGTGCATCCCCTGG + Exonic
1168078414 19:53992651-53992673 CCCAGGGCTGGGGAAGCCTCTGG - Exonic
1168559770 19:57373135-57373157 CCCATTGCTGGGGAGGCCTCAGG + Intronic
926086252 2:10022220-10022242 CCCAGGACTGAGGCATCCTCAGG - Intergenic
926461251 2:13131602-13131624 ACCATAGCTGGGGAGGCCTCAGG - Intergenic
926487992 2:13486713-13486735 CCCATGGCTGGGGCGGCCTCAGG - Intergenic
926827588 2:16922724-16922746 CACATAGCTGGGGAGGCCTCGGG - Intergenic
927600258 2:24434662-24434684 CCCATAGTTTGAGCCTCCTCTGG + Intergenic
927660918 2:24991982-24992004 CCCATGGCTGGGGAGGCCTCAGG - Intergenic
928695308 2:33843023-33843045 CTCATGGCTGGGGAGTCCTCAGG - Intergenic
928750054 2:34460102-34460124 CACATGGCTGGGGAAACCTCAGG - Intergenic
929113409 2:38424391-38424413 TGCATAGCTGGGGAAGCCTCAGG + Intergenic
929391144 2:41470537-41470559 CACATGGCTGGGGAGTCCTCAGG - Intergenic
929733461 2:44520937-44520959 CACATGGCTGGGGAAACCTCAGG - Intronic
930480492 2:51942945-51942967 CTCATGGCTGGGGAAGCCTCAGG - Intergenic
930505779 2:52281479-52281501 AGCATGGCTGGGGCAGCCTCAGG - Intergenic
930812707 2:55559685-55559707 CACATAGCTGGGGAGGCCTCAGG - Intronic
931983643 2:67721009-67721031 CACATGGCTGGGGAAGCCTCAGG - Intergenic
933362564 2:81306171-81306193 CACATAGCTGGGGAGGCCTCAGG - Intergenic
933410728 2:81921715-81921737 GGCATAGCTGGGGAAGCCTCAGG + Intergenic
933699358 2:85243658-85243680 CCCATGCCTGGGGCTGCCTCTGG - Intronic
933771579 2:85748038-85748060 CCCTTAGCTCGGGTAGCCTCAGG - Intergenic
933840484 2:86282396-86282418 CTCGTGGCTGGGGCATCCTTGGG + Intronic
934767694 2:96889186-96889208 CCCAGAGCTGGGGCAGAGTCAGG - Intronic
935344022 2:102087737-102087759 CACATAGCTGGAGCAGCCTCAGG - Intronic
935347772 2:102124503-102124525 CACATGGCTGGGGAAGCCTCGGG + Intronic
935351285 2:102153750-102153772 CGCATGGCTGGGGAAGCCTCAGG - Intronic
938141039 2:128794833-128794855 CTCATAGCAGGGGCCTCCCCTGG + Intergenic
939422382 2:141989783-141989805 CCCATGGCTGGGGAGGCCTCAGG - Intronic
940359829 2:152785791-152785813 CACATAGCTGGGGAAGCCTCAGG + Intergenic
940823519 2:158384584-158384606 AACATGGCTGGGGCAGCCTCAGG - Intronic
941524952 2:166596215-166596237 CTCATGGCTGGGGAGTCCTCAGG + Intergenic
942679711 2:178464404-178464426 CCCATGGCTGGGGAGGCCTCAGG + Exonic
943949693 2:194116992-194117014 CGCATGGCTGGGGAAGCCTCAGG + Intergenic
945449072 2:209973068-209973090 CCCATGGCTGGAGCAGCCTGAGG + Exonic
946577091 2:221087378-221087400 CAAATAGCTGGGGAAGCCTCAGG + Intergenic
946884176 2:224206584-224206606 GCCATGTCTGGGGCCTCCTCTGG + Intergenic
946968519 2:225066535-225066557 CCCATGGCTGGGGAGACCTCAGG - Intergenic
947495039 2:230628963-230628985 CTCATTGCTGGGGAAGCCTCAGG - Intergenic
947729928 2:232422062-232422084 CTCATAGCTGGGGAGCCCTCAGG - Intergenic
948806221 2:240454379-240454401 CCGGTGGCTGTGGCATCCTCCGG - Intronic
948877123 2:240835571-240835593 CCCAAAACTGGGTCATCCTGAGG + Intergenic
949039074 2:241837593-241837615 CCCATGGCTGGGGAAGCCTCAGG - Intergenic
1170963129 20:21043155-21043177 CCCATGGCTGGGGAGGCCTCTGG - Intergenic
1172459312 20:35103960-35103982 CGCATAGCTGGGGAAGCCTCAGG - Intergenic
1173532506 20:43781176-43781198 CCCATGGCTGGGGAGGCCTCAGG - Intergenic
1175275668 20:57768905-57768927 CACATTGCTGGGGAAGCCTCAGG - Intergenic
1175561927 20:59938602-59938624 CCCATAGCGGATGCCTCCTCAGG - Exonic
1175953091 20:62593820-62593842 CCCCAACCTGGGGCATCCTTTGG + Intergenic
1176120097 20:63450417-63450439 CCCACACCTGGGGCAGCCCCAGG - Intronic
1176633575 21:9163973-9163995 CCCAAATCTTGGTCATCCTCAGG - Intergenic
1176771293 21:13076589-13076611 CTCATAGCTGGGGAGGCCTCAGG - Intergenic
1177059308 21:16351701-16351723 CACATGGCTGGGGAAGCCTCAGG - Intergenic
1177146179 21:17409845-17409867 CGCATGGCTGGGGAAGCCTCAGG + Intergenic
1177270978 21:18849342-18849364 CACATTGCTGGGGAAGCCTCAGG - Intergenic
1177719310 21:24883833-24883855 CACATGGCTGGGGAGTCCTCAGG - Intergenic
1178033168 21:28551476-28551498 CGCATGGCTGGGGAAGCCTCAGG - Intergenic
1178097316 21:29230054-29230076 CACATAGCTGGGGAGGCCTCAGG + Intronic
1179160312 21:38890825-38890847 AGCATAGCTGGGGAAGCCTCAGG + Intergenic
1179385695 21:40940188-40940210 CACATGGCTGGGGAAGCCTCAGG + Intergenic
1179521143 21:41945835-41945857 CACATGGCTGGGGAAGCCTCAGG - Intronic
1179893539 21:44349722-44349744 CCCAAGGCTGGGGCAGGCTCAGG - Intergenic
1180436192 22:15306837-15306859 CTCATAGCTGGGGAGGCCTCAGG - Intergenic
1180518437 22:16171034-16171056 CTCATAGCTGGGGAGGCCTCAGG - Intergenic
1181463669 22:23099429-23099451 CACCCAGCTGGGGCTTCCTCAGG + Intronic
1181670938 22:24425179-24425201 CCCAGGGCTGGGGCACCCTGGGG - Intronic
1183061229 22:35337492-35337514 CCACTAGCTGGGGCATTCCCTGG - Intronic
1183330863 22:37220642-37220664 AGCATGGCTGGGGAATCCTCAGG + Intergenic
1183645015 22:39120328-39120350 TCCATAGCTGGGGCATCACTGGG + Intronic
1184249321 22:43251194-43251216 CCCACAGCTGGGGCAGCCAGCGG + Intronic
1184399963 22:44267979-44268001 CCCAAAGCCAGGGCAGCCTCCGG - Intronic
1184531956 22:45061881-45061903 CCCGGAGCTGGGGAATCCTGTGG + Intergenic
1184682716 22:46080514-46080536 CCCATAGCTGGGGCTGGCACCGG + Intronic
1184901528 22:47449314-47449336 CACATGGCTGGGGAAGCCTCGGG - Intergenic
1185123062 22:48984919-48984941 CCCATGGCTGGGGGACGCTCTGG - Intergenic
1185159615 22:49215315-49215337 CCCACAGCTGGGGCCCTCTCTGG + Intergenic
1185418483 22:50722234-50722256 CCCATAGCTTGGACCTTCTCTGG - Intergenic
949442824 3:4101896-4101918 CACATGGCTGGGGAAGCCTCAGG + Intronic
949575046 3:5330993-5331015 CACATAGCTGGGGAGGCCTCAGG + Intergenic
949801548 3:7909862-7909884 CCCACCGGTGGGCCATCCTCCGG + Intergenic
950931196 3:16790602-16790624 CACATAGCTGGGGAGGCCTCAGG - Intergenic
952342945 3:32460278-32460300 CCCAGAGCTGGCCCATTCTCTGG + Intronic
952504376 3:33994886-33994908 CACATGGCTGGGGAAGCCTCAGG + Intergenic
952505396 3:34002642-34002664 CGCATAGCTGGGGAGGCCTCAGG - Intergenic
954415767 3:50392532-50392554 CCCACAGCTGGGGGCACCTCAGG + Intronic
954662900 3:52235430-52235452 CCCAGAGCTCGGCCATCCTGCGG - Intronic
954671044 3:52291562-52291584 CCCAAGGCAGGGGCAACCTCAGG + Intronic
955254555 3:57316844-57316866 CACATGGCTGGGGAAGCCTCGGG - Intronic
956080544 3:65551249-65551271 CTCATGGCTGGGGAGTCCTCAGG - Intronic
957100445 3:75819969-75819991 CCCAAATCTTGGTCATCCTCAGG - Intergenic
957313852 3:78552178-78552200 CACATGGCTGGGGAAGCCTCAGG - Intergenic
957471723 3:80667573-80667595 CACATGGCTGGGGAAGCCTCAGG - Intergenic
957544859 3:81624082-81624104 CACATAGCTGGGGAGGCCTCAGG + Intronic
957871134 3:86091627-86091649 CACATGGCTGGGGAAGCCTCAGG - Intergenic
958000539 3:87743411-87743433 CACATGGCTGGGGAAGCCTCAGG + Intergenic
958935516 3:100251670-100251692 CACATGGCTGGGGAAGCCTCAGG + Intergenic
959402149 3:105915661-105915683 CGCATAGCTGGGAAGTCCTCAGG - Intergenic
959622411 3:108412400-108412422 ACCATGGCTGGGGCGACCTCAGG - Intronic
960181810 3:114588892-114588914 CGCATGGCTGGGGAAGCCTCAGG + Intronic
960501911 3:118448071-118448093 AGCATAGCTGGGGAAGCCTCAGG + Intergenic
962062806 3:131948409-131948431 CGCATTGCTGGGGAAGCCTCAGG - Intronic
962269127 3:133965308-133965330 CACATGGCTGGGGAGTCCTCAGG + Intronic
962311222 3:134328353-134328375 CCCACAGCTGAGTCATCCTTGGG + Intergenic
963229033 3:142891364-142891386 CACATGGCTGGGGAGTCCTCAGG + Intergenic
963878125 3:150499921-150499943 CACATGGCTGGGGAAGCCTCAGG + Intergenic
964170466 3:153764266-153764288 CACATAGCTGGGGAGGCCTCAGG - Intergenic
964853531 3:161120115-161120137 CACATGGCTGGGGAAGCCTCAGG - Intronic
965019397 3:163208274-163208296 AGCATGGCTGGGGCAGCCTCAGG - Intergenic
965879621 3:173372843-173372865 CACATGGCTGGGGAAGCCTCAGG - Intergenic
966042589 3:175509769-175509791 CGCAGAGCTGGGGAGTCCTCAGG + Intronic
966118789 3:176498691-176498713 CGCATAGCTGAGGAAGCCTCAGG + Intergenic
966643462 3:182216284-182216306 CACATGGCTGGGGAAGCCTCAGG + Intergenic
967076010 3:186002840-186002862 CACATAGCTGGGGAGACCTCAGG - Intergenic
967768126 3:193304832-193304854 CACATGGCTGGGGAAGCCTCAGG + Intronic
967916486 3:194582386-194582408 CCCAGACCTAGGGAATCCTCCGG + Intergenic
968086405 3:195875880-195875902 TCCAGAGCTGGGGCAGCCTTAGG - Intronic
968579034 4:1381179-1381201 CCTAAAGCTGGAGCATCCTCTGG - Intronic
969129467 4:4981020-4981042 CACACAGCTGGGGCATCCAAGGG + Intergenic
969415114 4:7052942-7052964 CCCACAGCTGGGGCTTCCTCTGG - Intronic
969917178 4:10502217-10502239 CACATGGCTGGGGAAGCCTCAGG + Intronic
970155850 4:13141172-13141194 CACATGGCTGGGGAAGCCTCAGG - Intergenic
970229452 4:13893748-13893770 CACATAGCTGGGGAGGCCTCAGG - Intergenic
970491858 4:16583048-16583070 TCCACAGCTCGGCCATCCTCAGG + Intronic
970758418 4:19453712-19453734 CCCATGGCTGGGGAGGCCTCAGG - Intergenic
971422691 4:26488669-26488691 CCCAAAGCTGGGGCCATCTCTGG - Intronic
971855059 4:32032379-32032401 CCCATGCCTGGGGAAGCCTCAGG + Intergenic
972033512 4:34492722-34492744 CACATGGCTGGGGAAGCCTCAGG - Intergenic
972063185 4:34906871-34906893 CACATGGCTGGGGAAGCCTCAGG - Intergenic
972929990 4:44060692-44060714 CACATGGCTGGGGAAGCCTCAGG + Intergenic
974334703 4:60526725-60526747 CTCATGGCTGGGGAAGCCTCAGG - Intergenic
974876024 4:67703748-67703770 CACATGGCTGGGGAGTCCTCAGG + Intergenic
975673795 4:76807094-76807116 CGCATAGCTGGGGAGGCCTCAGG + Intergenic
976050616 4:81008299-81008321 CACATAGCTGGGGAGGCCTCAGG - Intergenic
976735488 4:88304656-88304678 CCCATGGCTGGGGAGGCCTCAGG + Intergenic
977171313 4:93766283-93766305 CCCATGGCTGGGGAGGCCTCAGG + Intronic
977553011 4:98462139-98462161 CACATGGCTGGGGAAGCCTCAGG + Intergenic
978467079 4:109019492-109019514 CACATAGCTGGGGAGGCCTCAGG + Intronic
978879311 4:113681456-113681478 CACATTGCTGGGGAAGCCTCAGG - Intronic
978991128 4:115083823-115083845 CTCATGGCTGGGGAGTCCTCAGG - Intronic
979366265 4:119828028-119828050 CACATGGCTGGGGAAGCCTCAGG + Intergenic
979787370 4:124733063-124733085 CCCATGGCTTGGGAAGCCTCAGG - Intergenic
979839889 4:125424443-125424465 CCCAGAGCTGGGGAGGCCTCAGG - Intronic
979876642 4:125899621-125899643 CACATGGCTGGGGAAGCCTCAGG - Intergenic
980487922 4:133483884-133483906 CACATAGCTGAGGAAGCCTCAGG - Intergenic
980750280 4:137078313-137078335 AGCATGGCTGGGGCAGCCTCAGG + Intergenic
982382974 4:154769993-154770015 CCTATAGCTGGGGATGCCTCAGG + Intergenic
983396507 4:167204384-167204406 CACATAGCTGGGGAGGCCTCAGG + Intronic
984090046 4:175361795-175361817 CCCATGTCTGGGGCAGCCTCAGG - Intergenic
984219585 4:176956395-176956417 CACATGGCTGGGGAAGCCTCAGG + Intergenic
984329225 4:178293885-178293907 CACATGGCTGGGGAAGCCTCAGG - Intergenic
985076939 4:186225077-186225099 CCCATGGCTGGGGAGGCCTCAGG - Intronic
985119679 4:186627558-186627580 CCCAGAGCTGGGGCCTGCTGGGG - Intronic
985254263 4:188054177-188054199 CACATGGCTGGGGAAGCCTCAGG - Intergenic
985992583 5:3575572-3575594 CCCTGAGCTGAGGCGTCCTCTGG + Intergenic
986155309 5:5169006-5169028 CCCATAGCATGGGTATCCTATGG + Intronic
986971121 5:13338027-13338049 CACATGGCTGGGGGAGCCTCAGG + Intergenic
988018830 5:25597139-25597161 CACATGGCTGGGGAAGCCTCAGG + Intergenic
988408521 5:30855625-30855647 TCCATTGCTGGGGAGTCCTCAGG - Intergenic
989347530 5:40446643-40446665 CCCATGACTGGGGAAACCTCAGG + Intergenic
990083547 5:51945873-51945895 CACATAGCTGGGGAGGCCTCAGG - Intergenic
990929704 5:61074839-61074861 CGCATAGCTGGGGAGGCCTCAGG + Intronic
990933802 5:61124883-61124905 CCCATAGCTGGGGAGGCCTCAGG + Intronic
992710956 5:79455519-79455541 CACATGGCTGGGGAAGCCTCAGG - Intronic
994031978 5:95153306-95153328 CACATAGCTGGGGAGGCCTCAGG - Intronic
994152414 5:96462947-96462969 CACATGGCTGGGGAAGCCTCAGG - Intergenic
995311551 5:110717854-110717876 CACATAGCTGGGGAGGCCTCAGG - Intronic
995358913 5:111270910-111270932 CACATGGCTGGGGAAGCCTCCGG + Intronic
995709045 5:115016112-115016134 CACATAGCTGGGGAAGCCTCAGG - Intergenic
995997722 5:118321768-118321790 CACATAGCTGGGGAGGCCTCAGG + Intergenic
996326560 5:122281239-122281261 CCCATGGCTGGGGAAACCTCAGG - Intergenic
997386052 5:133473749-133473771 CCCATGGCTAGGGAAGCCTCAGG + Intronic
998315626 5:141180057-141180079 CCCTGGGCTGGGGCAGCCTCCGG - Exonic
998630301 5:143890839-143890861 CCCATAGCAGGGGGATTCTGAGG + Intergenic
999960792 5:156753611-156753633 CCCATGGCTGGGGAGGCCTCAGG + Intronic
1000099137 5:157998057-157998079 CACATTGCTGGGGAAGCCTCGGG - Intergenic
1000139263 5:158385642-158385664 CCCATGGCTGGGGAAGCCTCAGG + Intergenic
1000581510 5:163040162-163040184 CACATGGCTGGGGAAGCCTCAGG - Intergenic
1001450162 5:171818489-171818511 TCAGTAGATGGGGCATCCTCTGG - Intergenic
1001693069 5:173647109-173647131 ACCTCAGCTGGGGCATCCTATGG + Intergenic
1003760619 6:9174968-9174990 CCAATAGCCTGGGCACCCTCTGG - Intergenic
1004123894 6:12853607-12853629 CCCATTGCTGGGGAAGCCTCAGG + Intronic
1005256748 6:24011396-24011418 CACATAGCTGGGGAGACCTCAGG - Intergenic
1006657921 6:35612618-35612640 CACATGGCTGGGGAAGCCTCAGG + Intronic
1006944912 6:37778638-37778660 TCCATCTCTGGGGCATTCTCTGG - Intergenic
1007470723 6:42088585-42088607 CCCAGAGCTGGGGCCTGCTCAGG - Intergenic
1009051834 6:58284388-58284410 AGCATAGCTGGGGAAGCCTCAGG - Intergenic
1009685823 6:66955653-66955675 CTCATAGCTTGGGAATCCTCAGG + Intergenic
1010027220 6:71233147-71233169 TGCATAGCTGGGGAAGCCTCAGG - Intergenic
1010473985 6:76263575-76263597 CACATGGCTGGGGAAGCCTCAGG - Intergenic
1010618673 6:78045904-78045926 CACATGGCTGGGGAAGCCTCAGG + Intergenic
1011200908 6:84835065-84835087 CACATAGCTGGGGAGGCCTCTGG - Intergenic
1011657719 6:89566594-89566616 CCCCTATCAGGGACATCCTCCGG - Intronic
1012227828 6:96724885-96724907 CCCATTGCTGGCGCTTCATCTGG - Intergenic
1012733654 6:102911499-102911521 CACTTTGCTGGGGCAGCCTCAGG - Intergenic
1014342445 6:120227277-120227299 CCCATGGCTGTGGAAACCTCAGG + Intergenic
1014390678 6:120858754-120858776 CACATAGCTGGGGAGGCCTCAGG + Intergenic
1014719970 6:124904178-124904200 CACATGGCTGGGGAACCCTCAGG - Intergenic
1014928685 6:127306627-127306649 AGCATGGCTGGGGAATCCTCAGG - Intronic
1015249252 6:131109460-131109482 CCCATGGCTGGAGAAGCCTCAGG - Intergenic
1015309252 6:131747900-131747922 CGCATGGCTGGGGAAGCCTCAGG + Intergenic
1016234133 6:141841655-141841677 CACATAGCTGGGGAGACCTCAGG - Intergenic
1016703135 6:147076483-147076505 CACATGGCTGGGGTAGCCTCAGG - Intergenic
1017695955 6:157016572-157016594 CCCATAACTGGCACATCTTCGGG - Intronic
1018514449 6:164563012-164563034 CACATGGCTGGGGAAGCCTCAGG - Intergenic
1018523423 6:164679188-164679210 CCCATGGCTGGGGAGGCCTCAGG + Intergenic
1019058352 6:169238779-169238801 CCCAGAGCTGTGTCATCCTCAGG - Intronic
1019212513 6:170418078-170418100 CCTATAGCAGGGGCATCCGGAGG - Intergenic
1020537604 7:9421281-9421303 CACATGGCTGGGGAAGCCTCAGG - Intergenic
1021823321 7:24519624-24519646 CACATTGCTGGGGAAGCCTCAGG + Intergenic
1022735975 7:33076404-33076426 TGCATAGCTGGGGAAGCCTCAGG - Intergenic
1023218164 7:37887737-37887759 CGCATGGCTGGGGAAGCCTCAGG + Intronic
1024659664 7:51481165-51481187 CCCATAGCTGCAGCCTTCTCTGG - Intergenic
1024667136 7:51558401-51558423 TTCATGGCTGGGGCAACCTCAGG - Intergenic
1026252034 7:68679519-68679541 GACATAGCTTGGGAATCCTCTGG + Intergenic
1027481662 7:78705362-78705384 CACATGGCTGGGGAAGCCTCAGG - Intronic
1027660962 7:80987918-80987940 CACATAGCTGGGGAGGCCTCAGG + Intergenic
1027785556 7:82574978-82575000 CCCATGGCTGGGGAGGCCTCAGG + Intergenic
1029538388 7:101169027-101169049 CCCAGAGCTGGGGAATCCTGGGG + Intergenic
1030754536 7:113272156-113272178 CACATGGCTAGGGCAGCCTCAGG + Intergenic
1030785370 7:113653817-113653839 CGCATGGCTGGGGAAGCCTCAGG - Intergenic
1030895342 7:115052782-115052804 CACATGGCTGGGGAAGCCTCAGG + Intergenic
1031435737 7:121729751-121729773 CTCATGGCTGGGGAAGCCTCAGG + Intergenic
1032759418 7:134925512-134925534 CTCATAGCTGGGGAGGCCTCAGG + Intronic
1032916115 7:136492000-136492022 TGCATAGCTGGGGAAGCCTCAGG - Intergenic
1032976744 7:137232939-137232961 CACATAGCTGGGGAGACCTCAGG - Intronic
1033361847 7:140643556-140643578 CCCATTGCTGGGTCATCCTGTGG + Intronic
1033852787 7:145517572-145517594 CACATTGCTGGGGCAACCTCAGG + Intergenic
1033878950 7:145857954-145857976 CACATGGCTGGGGAAGCCTCAGG + Intergenic
1034014414 7:147566515-147566537 CTCATGGCTGGGGAAGCCTCTGG + Intronic
1034839044 7:154378765-154378787 CGCATGGCTGGGGAAGCCTCAGG + Intronic
1034954181 7:155323507-155323529 CACATGGCTGGGGAAGCCTCAGG - Intergenic
1035308050 7:157945875-157945897 CCAACAGCTGGGGCATTCTCAGG + Intronic
1036125814 8:6061217-6061239 CCCATGGCTGGGGAGACCTCAGG + Intergenic
1036476838 8:9101315-9101337 CGCATGGCTGGGGTAGCCTCAGG + Intronic
1036797693 8:11768321-11768343 CCTATAGCAGGGGCATCCTGGGG + Intergenic
1037359087 8:18054211-18054233 CCCACAGCCCGGGCTTCCTCTGG - Intergenic
1038386135 8:27147639-27147661 CACATGGCTGGGGAAGCCTCAGG - Intergenic
1038748387 8:30273940-30273962 CACATGGCTGGGGCTGCCTCAGG - Intergenic
1039015664 8:33146360-33146382 CCCATGGCTGGGGAGGCCTCAGG + Intergenic
1039437174 8:37567649-37567671 CCCAGGGCTGGCTCATCCTCAGG - Intergenic
1039961073 8:42248144-42248166 CACATAGCTGGGGAGGCCTCGGG - Intergenic
1040645166 8:49388978-49389000 CCCATGGCTGGGGAGGCCTCAGG - Intergenic
1040782697 8:51129162-51129184 CGCATGGCTGGGGAGTCCTCAGG + Intergenic
1042057828 8:64785866-64785888 CACATAGCTGGGGAGGCCTCAGG + Intronic
1042803095 8:72742447-72742469 CCCATGGCTGGTGCAGCCTTGGG + Intronic
1044414374 8:91919571-91919593 CACATAGCTGGGGTGGCCTCAGG + Intergenic
1045456119 8:102380954-102380976 CACATGGCTGGGGAAGCCTCAGG + Intronic
1045649401 8:104328338-104328360 CCCAAAGATGGCTCATCCTCAGG + Intergenic
1045868877 8:106902684-106902706 CACATAGCTGGGGAGACCTCAGG - Intergenic
1046272786 8:111917681-111917703 GCCATAGCTGGGGCAGTCACAGG + Intergenic
1046520978 8:115325612-115325634 CACATGGCTGGGGAAGCCTCAGG + Intergenic
1047178784 8:122567582-122567604 CACATGGCTGGGGAATCCTCAGG + Intergenic
1047326665 8:123845132-123845154 CCTATAGCCTGGGCATTCTCAGG + Intergenic
1047608960 8:126502102-126502124 CCCATGGCTGGGGAGGCCTCAGG - Intergenic
1048121249 8:131583919-131583941 CACATAGCTGGGGATTCCTCAGG + Intergenic
1048405685 8:134117940-134117962 CACATAGCTGGGGAGGCCTCAGG + Intergenic
1048589146 8:135804860-135804882 CACATAGCTGGGGAGGCCTCAGG - Intergenic
1048613653 8:136051030-136051052 CCCACAGCTGGGGGTGCCTCAGG - Intergenic
1048801681 8:138199662-138199684 TCCATAGCTGGGGAGGCCTCAGG + Intronic
1048899699 8:139025476-139025498 CCCAGGGCTGGGGAAGCCTCAGG - Intergenic
1048904376 8:139073709-139073731 CGCATGGCTGGGGCGGCCTCAGG - Intergenic
1049197244 8:141322652-141322674 CCCACACCTGGAGCACCCTCAGG + Intergenic
1049472606 8:142783100-142783122 CCCCTTGCTGGGGCATCTGCCGG - Intergenic
1049472907 8:142784206-142784228 CCCCTTGCTGGGGCATCTGCCGG + Intergenic
1049598419 8:143495465-143495487 CTCAGAGCTGGGGCTGCCTCTGG + Intronic
1049871735 8:144984402-144984424 CACATAGCTGGGGAGGCCTCAGG - Intergenic
1050385614 9:5087206-5087228 CCCATGGCTGGGGAGGCCTCAGG + Intronic
1050940399 9:11450936-11450958 CACATGGCTGGGGCGGCCTCAGG - Intergenic
1051551395 9:18333431-18333453 CACATGGCTGGGGAGTCCTCAGG - Intergenic
1052273405 9:26651598-26651620 CACATGGCTGGGGAAGCCTCAGG + Intergenic
1052662794 9:31457348-31457370 CACATGGCTGGGGAAGCCTCAGG - Intergenic
1053703945 9:40730718-40730740 CTCATAGCTGGGGAGGCCTCAGG + Intergenic
1054414028 9:64854327-64854349 CTCATAGCTGGGGAGGCCTCAGG + Intergenic
1054828064 9:69592749-69592771 CGCATGGCTGGGGAAGCCTCAGG - Intronic
1055172247 9:73272932-73272954 CACATGGCTGGGGAAGCCTCAGG - Intergenic
1058061403 9:100500677-100500699 TCCATATCTAGGACATCCTCAGG + Intronic
1059213157 9:112533634-112533656 CCCATTGCTGGGGAGACCTCAGG + Intronic
1059269171 9:113061335-113061357 CCGCCAGCTGGGCCATCCTCTGG - Intergenic
1059270306 9:113066784-113066806 CCGCCAGCTGGGCCATCCTCTGG - Intergenic
1059271442 9:113072234-113072256 CCGCCAGCTGGGCCATCCTCTGG - Intergenic
1059272573 9:113077678-113077700 CCGCCAGCTGGGCCATCCTCTGG - Intergenic
1059273708 9:113083120-113083142 CCGCCAGCTGGGCCATCCTCTGG - Intergenic
1059274843 9:113088566-113088588 CCGCCAGCTGGGCCATCCTCTGG - Intergenic
1060794495 9:126504798-126504820 CCCCCACCAGGGGCATCCTCGGG - Exonic
1061561949 9:131410286-131410308 CCCAGAGCTGGTGCAGACTCTGG + Intronic
1062716532 9:138013287-138013309 CCCATGGCTGGGCCCTCCCCAGG + Intronic
1062733492 9:138121750-138121772 CCCTTACCTGGGGCAGCGTCTGG + Exonic
1203756414 Un_GL000218v1:131598-131620 CCCAAATCTTGGTCATCCTCAGG - Intergenic
1185992970 X:4912550-4912572 CCCATGGCTGGGGAGGCCTCAGG - Intergenic
1186106859 X:6216534-6216556 CCCAAATCTGGAGCATCCTCAGG - Intronic
1186233167 X:7478166-7478188 CCCATGGCTGGGGAGGCCTCAGG + Intergenic
1186994707 X:15107621-15107643 CACACAGCTGGGGTATCCTTTGG - Intergenic
1187603488 X:20858884-20858906 CACATAGCTGGGGAGACCTCAGG - Intergenic
1187815091 X:23223140-23223162 CCCATGGCTGGGGAGGCCTCAGG + Intergenic
1188221384 X:27545741-27545763 CACATGGCTGGGGAAGCCTCAGG + Intergenic
1188662189 X:32774506-32774528 CGCATGGCTGGGGAAGCCTCAGG + Intronic
1189433218 X:40968153-40968175 CGCATAGCTGGGGAAGCCTCAGG + Intergenic
1190387488 X:49897183-49897205 CATATAGCTGGGGAAGCCTCAGG - Intergenic
1190466309 X:50727679-50727701 CCCATGGCTGGGGAGGCCTCAGG - Intronic
1194045420 X:88995771-88995793 CACATAGCTGGGGAGGCCTCAGG + Intergenic
1194540161 X:95159771-95159793 CACATTGCTGGGGAAGCCTCAGG - Intergenic
1194720766 X:97337546-97337568 CACATGGCTGGGGAGTCCTCAGG - Intronic
1194781119 X:98026936-98026958 CACATTGCTGGGGCAGCATCAGG + Intergenic
1194875964 X:99187884-99187906 CCCATGGCTGGGGAGGCCTCAGG - Intergenic
1195150006 X:102057658-102057680 TCCATGGCTGGGGAAGCCTCAGG - Intergenic
1196836332 X:119817293-119817315 CACATGGCTGGGGGAGCCTCAGG + Intergenic
1196837308 X:119825176-119825198 CACATGGCTGGGGGAGCCTCAGG + Intergenic
1197040619 X:121931638-121931660 CGCATGGCTGGGGAAGCCTCAGG + Intergenic
1197583046 X:128309924-128309946 CACATAGCTGGGGAGGCCTCAGG + Intergenic
1199288769 X:146083057-146083079 CACATGGCTGGGGAAGCCTCAGG + Intergenic
1199293750 X:146134454-146134476 CGCATGGCTGGGGAAACCTCAGG + Intergenic
1199324604 X:146482780-146482802 AGCATAGCTGGGGAGTCCTCAGG + Intergenic
1199823058 X:151470453-151470475 CCCATCGCTGGGGAGGCCTCAGG + Intergenic
1200164033 X:154023896-154023918 ACCAGGGCTGGGGCAGCCTCTGG - Intronic
1200173897 X:154098245-154098267 CCCTCAGCTGGGGCAACGTCAGG - Intergenic
1200180915 X:154150238-154150260 CCACTAGCTGGGGAATCTTCTGG + Intronic
1200186558 X:154187352-154187374 CCACTAGCTGGGGAATCTTCTGG + Intergenic
1200192210 X:154224490-154224512 CCACTAGCTGGGGAATCTTCTGG + Intronic
1200197965 X:154262294-154262316 CCACTAGCTGGGGAATCTTCTGG + Intronic
1200533757 Y:4368574-4368596 CATATAGCTGGGGAAGCCTCAGG + Intergenic
1201490599 Y:14537140-14537162 CCCAAATCTGGAGCATCCTCAGG + Intronic
1201978190 Y:19875812-19875834 CACATGGCTGGGGAAGCCTCAGG - Intergenic