ID: 905281141

View in Genome Browser
Species Human (GRCh38)
Location 1:36850194-36850216
Sequence AGATGGAGGCTGCAGGTAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1158
Summary {0: 1, 1: 1, 2: 5, 3: 97, 4: 1054}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905281141_905281157 18 Left 905281141 1:36850194-36850216 CCACCTACCTGCAGCCTCCATCT 0: 1
1: 1
2: 5
3: 97
4: 1054
Right 905281157 1:36850235-36850257 AGGGGACTCTCCAGCCCGAACGG 0: 1
1: 0
2: 0
3: 13
4: 101
905281141_905281156 0 Left 905281141 1:36850194-36850216 CCACCTACCTGCAGCCTCCATCT 0: 1
1: 1
2: 5
3: 97
4: 1054
Right 905281156 1:36850217-36850239 TCTGGGTGGGGGGGATAGAGGGG 0: 1
1: 0
2: 3
3: 33
4: 482
905281141_905281152 -9 Left 905281141 1:36850194-36850216 CCACCTACCTGCAGCCTCCATCT 0: 1
1: 1
2: 5
3: 97
4: 1054
Right 905281152 1:36850208-36850230 CCTCCATCTTCTGGGTGGGGGGG 0: 1
1: 0
2: 4
3: 46
4: 355
905281141_905281154 -2 Left 905281141 1:36850194-36850216 CCACCTACCTGCAGCCTCCATCT 0: 1
1: 1
2: 5
3: 97
4: 1054
Right 905281154 1:36850215-36850237 CTTCTGGGTGGGGGGGATAGAGG 0: 1
1: 0
2: 5
3: 35
4: 384
905281141_905281150 -10 Left 905281141 1:36850194-36850216 CCACCTACCTGCAGCCTCCATCT 0: 1
1: 1
2: 5
3: 97
4: 1054
Right 905281150 1:36850207-36850229 GCCTCCATCTTCTGGGTGGGGGG 0: 1
1: 0
2: 3
3: 27
4: 340
905281141_905281155 -1 Left 905281141 1:36850194-36850216 CCACCTACCTGCAGCCTCCATCT 0: 1
1: 1
2: 5
3: 97
4: 1054
Right 905281155 1:36850216-36850238 TTCTGGGTGGGGGGGATAGAGGG 0: 1
1: 0
2: 3
3: 30
4: 384

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905281141 Original CRISPR AGATGGAGGCTGCAGGTAGG TGG (reversed) Intronic
900093813 1:932288-932310 AGGAGGGGGCTGCAGGCAGGAGG - Intronic
900106740 1:984707-984729 AGGTGGAGGCTGCAGTGAGCTGG - Intergenic
900629029 1:3624206-3624228 TGGTGGAGGCTGCGGGAAGGAGG - Intergenic
900788316 1:4663559-4663581 AAATGCAGGCTGCAGGTGGGAGG + Intronic
900946278 1:5833102-5833124 AAAACGAGGCTGCAGGTGGGCGG - Intergenic
900998813 1:6137175-6137197 AGGTGGAGGCTGCAAGTGAGTGG - Intronic
901358943 1:8678589-8678611 AGGCGGAGGTTGCAGGGAGGCGG + Intronic
901358948 1:8678606-8678628 AGGCGGAGGTTGCAGGGAGGCGG + Intronic
901422503 1:9160634-9160656 AGGTGGAGGCTGCAGTGAGCTGG - Intergenic
901442178 1:9284985-9285007 AGACGGAGGTTGCAGTGAGGAGG - Intergenic
901487855 1:9577706-9577728 AAATGGAGGATGGAGGTAGGGGG + Intronic
901823423 1:11845152-11845174 AGGTGGAGGCTGCAGTGAGCTGG - Intergenic
901889024 1:12246106-12246128 AGCTTGAGGGTGCAGGGAGGTGG + Intronic
902135683 1:14302930-14302952 GGGTGGAGGCTGCAGCAAGGTGG + Intergenic
902667950 1:17952693-17952715 AGGTGGAGGCTGCAGGAAGAAGG + Intergenic
904122756 1:28212342-28212364 AGATTGAGGCTGCAGTGAGCTGG - Intronic
904712157 1:32438388-32438410 AGATGAAGCCTCCAGGTAGCAGG - Intergenic
904762077 1:32812646-32812668 AGATGAAGCCTCCAGGTAGCTGG - Intronic
904799600 1:33082964-33082986 AGAAGGATGCTGCAGGCAGAAGG - Intronic
905170426 1:36106647-36106669 TGATGGAGGGTGCAGCTGGGAGG + Intronic
905171699 1:36113631-36113653 AGCTGGAGGGTGGAGGGAGGTGG + Intronic
905281141 1:36850194-36850216 AGATGGAGGCTGCAGGTAGGTGG - Intronic
905546913 1:38807436-38807458 TGATGGGGGCTCCAGGCAGGAGG - Intergenic
905991884 1:42344706-42344728 AGGTGGAGGCTGCAGGGAGGCGG + Intergenic
906290987 1:44619062-44619084 AGATGGGGGCTGGAGGTTGAAGG + Intronic
906306864 1:44725045-44725067 AGAGGGATGTTGCAGGTGGGGGG - Intronic
906323955 1:44832758-44832780 ATAGGGAGGCTGCTGCTAGGAGG + Intronic
906340519 1:44975897-44975919 AGGTGGAGGCTGCAGTGAGGTGG + Intronic
906632003 1:47379302-47379324 AGATGAAGCCTTCAGGTAGCAGG + Intergenic
906653707 1:47533140-47533162 AGAGGGAGGATGGAGGAAGGGGG - Intergenic
907189158 1:52633990-52634012 AGATGGAAGTTGCTGTTAGGGGG - Intronic
907510522 1:54954615-54954637 AGGTGGGGGCTGCAGGGAGGAGG + Intergenic
908256132 1:62305047-62305069 AAAAGGAGGGTGCAGGAAGGAGG + Intronic
909014218 1:70365796-70365818 AGATGAAGTCTCCAGGTAGCAGG - Intronic
909201558 1:72695486-72695508 AGATGAAGCCTCCAGGTAGCAGG + Intergenic
909643818 1:77894783-77894805 AGGTGGAGGTTGCAGTTAGCCGG - Intronic
910797497 1:91113495-91113517 AGATGGAGGTTGCAGTGAGCTGG + Intergenic
911407650 1:97462896-97462918 AGATGAAGCCTCCAGGTAGCAGG - Intronic
911493237 1:98595562-98595584 AGGTGGAGGTTGCAGGAAGCCGG - Intergenic
912879704 1:113398096-113398118 GGGTGGGGGCTGCAGGTAAGTGG - Intronic
912954642 1:114146219-114146241 AGAAGCAGGCAGCAGGGAGGAGG + Intronic
913105928 1:115613930-115613952 AGGTGGAGGCTGAGGGTGGGAGG - Intergenic
913209155 1:116569316-116569338 AGAGGAAGGCTGCAGTCAGGAGG - Intronic
913652686 1:120933460-120933482 AGATGAAGCCTCCAGGTAGCAGG - Intergenic
913681638 1:121191477-121191499 ATATGGAACCTGCAGGTATGGGG + Intronic
914033473 1:143979115-143979137 ATATGGAACCTGCAGGTATGGGG + Intergenic
914044619 1:144080373-144080395 AGATGGAGCCTCCAGGTAGCAGG - Intergenic
914080907 1:144410761-144410783 AGATGAAGCCTCCAGGTAGCAGG + Intergenic
914133491 1:144880313-144880335 AGATGGAGCCTCCAGGTAGCAGG + Intergenic
914155974 1:145088855-145088877 ATATGGAACCTGCAGGTATGGGG - Intronic
914168414 1:145195589-145195611 AGATGAAGCCTCCAGGTAGCAGG + Intergenic
914175822 1:145279292-145279314 AGATGAAGCCTCCAGGTAGCAGG + Intergenic
914239636 1:145844979-145845001 AGATGGAGGTTGCAGTGAGCTGG + Intergenic
914267152 1:146048046-146048068 AGATGAAGCCTCCAGGTAGCAGG - Intergenic
914530541 1:148520777-148520799 AGATGAAGCCTCCAGGTAGCAGG + Intergenic
914886913 1:151593026-151593048 AGATGAAGCCTCCAGGTAGCAGG - Intergenic
914897485 1:151689916-151689938 AGGTGGAGGCTGCAGTGAGCCGG - Intronic
915201124 1:154229923-154229945 AGGTGGAGGCTGCAGAGAGCAGG - Intronic
915214864 1:154333241-154333263 AGGCGGAGGTTGCAGGGAGGCGG + Intronic
915436759 1:155912353-155912375 AGGTGGAGGTTGCAGTTAGCTGG + Intergenic
915906105 1:159878421-159878443 AGATGAATGGTGCAGGTTGGAGG + Intronic
916329382 1:163596961-163596983 AGATGAAGCCTCCAGGTAGCAGG + Intergenic
916801344 1:168219490-168219512 AGATGAAGCCTCCAAGTAGGAGG + Intergenic
917097978 1:171418555-171418577 AGATGAAGCCTCCAGGTAGCAGG + Intergenic
917123027 1:171660871-171660893 AGATGAAGCCTCCAGGTAGCAGG + Intergenic
917150887 1:171943464-171943486 AGATGAAGCCTCCAGGTAGCAGG - Intronic
917276081 1:173333370-173333392 ACGTGAAGGCAGCAGGTAGGAGG - Intergenic
917458395 1:175205536-175205558 AGATGAAGCCTCCAGGTAGCAGG + Intergenic
917530713 1:175832623-175832645 AGATGAAGCCTCCAGGTAGCAGG + Intergenic
917923190 1:179767662-179767684 AGCAGCAGGCTGCAGGTAGGGGG - Intronic
918065743 1:181100482-181100504 GGATGGGGGGTGGAGGTAGGGGG - Intergenic
918802573 1:188990668-188990690 AGATGAAGCCTGCTGGTAGCTGG - Intergenic
919673213 1:200356686-200356708 AGGTGGAGGCTGCAGTGAGCCGG + Intergenic
920468954 1:206209994-206210016 ATATGGAACCTGCAGGTATGGGG + Intronic
921098069 1:211903961-211903983 AGCTTGAGGCTTCTGGTAGGAGG + Intergenic
921266151 1:213422177-213422199 AGATGAGGGCTGGAGGAAGGAGG - Intergenic
921322285 1:213953713-213953735 AGGTGGAGGCTGGGGGTGGGAGG - Intergenic
921334480 1:214072633-214072655 AGAGGGAGGCAGCAGGGGGGAGG - Intergenic
921368573 1:214398833-214398855 AGGTGGAGGTTGCAGTTAGCCGG - Intronic
921472262 1:215563554-215563576 AGATGGAGGTTGCAGTGAGCTGG - Intergenic
921612710 1:217231339-217231361 AGATGGAGGTTGCAGTGAGCTGG - Intergenic
921663206 1:217832872-217832894 AGATCGAGGCTGCAGTGAGCTGG + Intronic
922118947 1:222643762-222643784 AGATGGTGGCTGCGGGGAAGGGG - Intronic
922166348 1:223118629-223118651 AGATGAAGCCTCCAGGTAGCAGG + Intronic
922166550 1:223120265-223120287 AGATGAAGCCTCCAGGTAGCAGG - Intronic
922501234 1:226098466-226098488 AGATGGAGGCTGGAGGTAACTGG - Intergenic
923066379 1:230521122-230521144 AGATGAAGCCTCCAGGTAGCAGG + Intergenic
923417336 1:233776202-233776224 AGATGGAGGGTGGAGGTGAGAGG + Intergenic
923596242 1:235362491-235362513 AGTTGGAGGCTGTAGGCTGGGGG - Intergenic
923666147 1:236000311-236000333 AGATGAAGCCTCCAGGTAGGCGG - Intronic
923769845 1:236928908-236928930 AGATGAAGCCTCCAGGTAGCCGG - Intergenic
924573225 1:245257035-245257057 AGATGAAGCCTCCAGGTAGCAGG - Intronic
1062953250 10:1521609-1521631 AGATGAAGCCTCCAGGTAGCAGG - Intronic
1062979870 10:1713112-1713134 CGATGGAGGCTGCAGACATGGGG + Intronic
1063018568 10:2102873-2102895 AGATGAAGCCTCCAGGTAGCAGG + Intergenic
1063102722 10:2964396-2964418 AGATGAAGACTCCAGGTAGCAGG - Intergenic
1063186983 10:3660517-3660539 AGATGGAGACTGGAGACAGGGGG + Intergenic
1063410500 10:5833213-5833235 GGATGGAGGCTGCAGGGAGCAGG + Intronic
1063848504 10:10159578-10159600 AGATGAAGCCTCCAGGTAAGAGG + Intergenic
1064160831 10:12944291-12944313 AGATGAAGCCTCCAGGTAGCAGG - Intronic
1064237022 10:13585804-13585826 AGATGGAGGTTGCAGTGAGCCGG - Intergenic
1064997966 10:21313115-21313137 AGGTGGAGGCTGAAGTGAGGAGG - Intergenic
1065308848 10:24395021-24395043 ACATGGATGCTGCAGGTCAGGGG + Intronic
1065365671 10:24934524-24934546 AGATGAAGCCTTCAGGTAGCAGG - Intronic
1065604016 10:27397440-27397462 AGATGGAGGTTGCAGTGAGCTGG - Intergenic
1066109293 10:32182121-32182143 AGGTGGAGGCTGCAGTGAGCTGG - Intergenic
1066386422 10:34945237-34945259 AGATGAAGCCTCCAGGTGGGAGG + Intergenic
1066956747 10:42180060-42180082 AGATGAAGCCTCCAGGTAGCAGG - Intergenic
1067122294 10:43483936-43483958 AGATGGAGGTTGCAGGGAGGCGG - Intergenic
1067266038 10:44746067-44746089 AGATGAAGCCTCCAGGTAGCAGG + Intergenic
1067341455 10:45408510-45408532 AGATGAAGCCTCCAGGTAGCAGG + Intronic
1067856317 10:49796633-49796655 AGATGAAGCCTCCAGGTAGCAGG + Intergenic
1068029688 10:51691375-51691397 AGGTGGAGGCTGCAGTGAGCCGG - Intronic
1068047522 10:51906654-51906676 AGATGAAGCCTCCAGGTAGCAGG + Intronic
1068177197 10:53476794-53476816 AGATGAAGCCTCCAGGTAGTAGG + Intergenic
1068392024 10:56409704-56409726 AGAAGGAGGATGCAGGAAGGAGG + Intergenic
1068418996 10:56764591-56764613 AGATGAAGCCTCCAGGTAGCAGG + Intergenic
1068525212 10:58120982-58121004 GGATGGAGGGTGCAGGATGGAGG + Intergenic
1068644443 10:59450311-59450333 ACATGGAGACTGAAGGTAGGTGG - Intergenic
1068739243 10:60450222-60450244 AGTTGGAGGCTGCAGTGAGTTGG + Intronic
1068874784 10:61984543-61984565 ATGTGGAGGCAGCAGGTGGGGGG + Intronic
1069045747 10:63741499-63741521 ATCAGGAGGCTGCAGGTGGGAGG - Intergenic
1069196820 10:65561351-65561373 AGATGAAGCCTCCAGGTAGCAGG - Intergenic
1069732425 10:70626160-70626182 AGATGAAGCCTCCAGGTAGCAGG - Intergenic
1070077804 10:73155133-73155155 AGGTGGAGGTTGCAGGGAGGTGG - Intronic
1070257826 10:74826241-74826263 AGGTGGAGGGGGCGGGTAGGTGG + Intronic
1070430803 10:76335791-76335813 AGATGAAGCCTACAGGTAGCAGG + Intronic
1070539895 10:77408583-77408605 AGCTGGAGGCTGCAGCCAGTGGG - Intronic
1070731365 10:78830913-78830935 ACATGGGGGCTGCAGGGATGGGG - Intergenic
1070773625 10:79097248-79097270 AGATGGAGGTGGCCGGTGGGAGG - Intronic
1070949077 10:80416493-80416515 AGTGGGAGGCTGGAAGTAGGGGG + Intronic
1071009601 10:80922583-80922605 AGTTGGAGGGTGCAGGGAAGAGG + Intergenic
1071012120 10:80951724-80951746 AGATGAAGCCTCCAGGTAGCAGG - Intergenic
1071032125 10:81197242-81197264 AGATGAAGCCTCCAGGTAGCAGG - Intergenic
1071198903 10:83194773-83194795 AGATGGAGCCTTCAGGTAACAGG - Intergenic
1071235746 10:83646253-83646275 AGATGAAGCCTCCAGGTAGCAGG + Intergenic
1071959455 10:90795979-90796001 AGATGAAGCCTCCAGGTAGCAGG + Intronic
1072141380 10:92592070-92592092 AGATAGAGGCTGCAGTGAGCCGG - Intergenic
1072941537 10:99768496-99768518 AGATGGAGGTTGCAGTGAGCTGG + Intergenic
1073237525 10:102030853-102030875 AGGTGGAGGTTGCAGTGAGGCGG - Intronic
1073396037 10:103218378-103218400 AGATGAAGCCTCCAGGTAGCAGG + Intergenic
1073505391 10:103983563-103983585 AGAGGGAGGCTGCAAGGAGAAGG + Intronic
1073656098 10:105418496-105418518 ATATGGATGCAGCAGGTAGAAGG - Intergenic
1073794256 10:106970806-106970828 AGTTGGAGGCTGCAGTGAGCTGG - Intronic
1075226121 10:120630797-120630819 AGATGGAGCCTTCAGGTAGTAGG - Intergenic
1075777044 10:124995889-124995911 GGATGGAGGCTGCAGGAACGGGG - Intronic
1076131795 10:128018622-128018644 AGATGGAGGCTGTGGGGAGGCGG - Intronic
1076358271 10:129868636-129868658 AGAAGGAGGGTGCAGGGGGGAGG + Intronic
1076378676 10:130010375-130010397 AGATGAAGCCTCCAGGTAGCAGG + Intergenic
1076473043 10:130733132-130733154 ACATGGAGTTTGTAGGTAGGAGG - Intergenic
1076567366 10:131407903-131407925 AAAAGGAGGATGCAGGTAAGAGG - Intergenic
1076654063 10:132009841-132009863 AACTGGAGGCAGCAGGGAGGAGG - Intergenic
1076677707 10:132156023-132156045 GGAAGGAGGCTGGAAGTAGGTGG + Intronic
1076812040 10:132891700-132891722 AGATGAAGCCTCCAGGTAGCCGG - Intronic
1077038789 11:508233-508255 AGGTGGAGGCTGCAGCGAGCTGG - Intergenic
1077082065 11:728646-728668 AGCTGCAGGTTGCAGGGAGGAGG - Intergenic
1077205123 11:1338334-1338356 AGATGGAGGATGCAGAGAGGTGG - Intergenic
1077221664 11:1420707-1420729 GGGAGGAGGCTGCAGGGAGGAGG - Intronic
1077235410 11:1479808-1479830 CCTTGGAGGCTGCAGGCAGGAGG - Intronic
1077239813 11:1504638-1504660 AGGTGGAGGCTGCAGCGAGCGGG + Intergenic
1077359134 11:2132934-2132956 AGGAGGAGGCTGCAGGATGGTGG + Exonic
1077539560 11:3140138-3140160 AGATGGTGGCTGCAATTTGGGGG - Intronic
1077558562 11:3240763-3240785 AGATGAAGCCTCCAGGTAGCAGG + Intergenic
1077652976 11:3991238-3991260 AGATTGAGGCTGCAGTGAGCTGG - Intronic
1077871437 11:6265545-6265567 AGGTGGAGGCTGGGGGTGGGAGG + Intronic
1078090394 11:8261458-8261480 AGATCCTGGGTGCAGGTAGGGGG + Intronic
1078225699 11:9389827-9389849 AGATGGAGGTTGCAGTGAGCCGG - Intronic
1078242117 11:9539267-9539289 AGGTGGAGGCTGCAGTGAGCCGG - Intergenic
1078744303 11:14096574-14096596 CAGTGGAGGCTGCAGGTGGGTGG + Intronic
1079584364 11:22107490-22107512 GGATGAAAGCTGCAGGCAGGAGG - Intergenic
1080010489 11:27454026-27454048 AGATGAAGCCTCCAGGTAGCAGG - Intronic
1080650931 11:34222245-34222267 AGATGAAGCCTCCAGGTAGCAGG + Intronic
1080879145 11:36302715-36302737 AGGTGGAGCTTGCAGTTAGGTGG + Intronic
1081822535 11:46013497-46013519 AAATGGAAACTGCAGGTAAGTGG + Intronic
1081873168 11:46392234-46392256 AGCGGGAGGCTGCGGGTGGGTGG + Intergenic
1082262065 11:50084135-50084157 AGATGGAGGTTGCAGTAAGCTGG - Intergenic
1082278875 11:50248028-50248050 AGGCGGAGGTTGCAGGGAGGCGG + Intergenic
1082689478 11:56282305-56282327 AGATGAAGCCTCCAGGTAGCAGG - Intergenic
1082916116 11:58439407-58439429 AGATGGAAACTGCAGTAAGGTGG + Exonic
1083105922 11:60358704-60358726 AGATGAAGCCTTCAGGTAGCAGG + Intronic
1083553304 11:63606972-63606994 AGATGTAGGGTGCAAGGAGGAGG + Intronic
1083755204 11:64788520-64788542 AGATGCAGGCTCCAGCAAGGAGG + Intergenic
1083870543 11:65485319-65485341 AGGTGGAGGTTGCAGTGAGGCGG + Intergenic
1083951687 11:65960016-65960038 AGTTGGAGGTGGCAGGTGGGTGG + Intergenic
1084025459 11:66445728-66445750 AGATGAAGTCTCCAGGTAGCAGG - Intronic
1084050249 11:66594704-66594726 AGGTGGAGGCTGCAGTGAGTTGG + Intronic
1084172366 11:67406704-67406726 ACATGGGGGCTGGAGGAAGGAGG + Intronic
1084365491 11:68694927-68694949 AGATGAAGCCTCCAGGTAGCAGG - Intergenic
1084531111 11:69728367-69728389 AGGTCCAGGCAGCAGGTAGGAGG + Intergenic
1084614833 11:70228786-70228808 AGATGAAGGCTTCAAGTAGTAGG - Intergenic
1084683925 11:70682662-70682684 AAATGGGGGAGGCAGGTAGGAGG + Intronic
1084740262 11:71134857-71134879 AGATGGGGGCTCCAGGTAAATGG - Intronic
1085268139 11:75249926-75249948 AGAGGGGGGCTGCAGGCTGGGGG - Intergenic
1085287860 11:75375755-75375777 AGATGGAGGAGGCAGGAAGGGGG - Intergenic
1085409305 11:76281990-76282012 AGAAGCAGGCTGCAGGGAGATGG - Intergenic
1085630966 11:78116281-78116303 AGGTGGAGGTTGCAGTGAGGTGG + Intronic
1086283081 11:85213557-85213579 AGATGAAGCCTACAGGTAGCAGG + Intronic
1086949944 11:92881945-92881967 AGCTGGGGGCTGCAGGTGGGTGG - Intronic
1087470527 11:98568550-98568572 AGATGGAGGTTGCAGCGAGCTGG - Intergenic
1087701948 11:101444795-101444817 AGATGAAGCCTCCAGGTAGCAGG + Intergenic
1088545093 11:110951260-110951282 AAATGGAGGAAGCAGGCAGGGGG + Intergenic
1088866250 11:113850829-113850851 AGGTCCAGGCTGGAGGTAGGTGG - Intronic
1089535591 11:119158945-119158967 AGATGGAGGCAGTGGGCAGGTGG - Intronic
1089710286 11:120309648-120309670 AGGTGGTGGCTGCAGGGAAGAGG + Intronic
1089935390 11:122359201-122359223 AGATGGAAGCTGCAGCCACGGGG - Intergenic
1090028212 11:123185520-123185542 AGAAGGAGGCTGCGGAGAGGTGG + Intronic
1090238237 11:125164964-125164986 AGAGGGAGGCAGCAGGGAGGAGG + Intronic
1090254596 11:125274614-125274636 ACATGTCGGCTGCAGCTAGGAGG + Intronic
1091306361 11:134538797-134538819 AGAGGCAGGCTGGAGGGAGGGGG + Intergenic
1091362571 11:134989278-134989300 AGATGAAGGCTTCAGGTAGTAGG - Intergenic
1091413161 12:257586-257608 AGGTGGAGGCAGCAGGGCGGCGG - Intronic
1092645736 12:10570011-10570033 AGATGAAGTCTCCAGGTAGCAGG - Intergenic
1092721999 12:11450565-11450587 AGATGAAGCCTCCAAGTAGGAGG + Intronic
1092725976 12:11485926-11485948 AGATGAAGCCTCCAGGTAGCAGG - Intronic
1092939178 12:13391362-13391384 AGATAGTGGCTGAATGTAGGAGG - Intergenic
1093058536 12:14579171-14579193 AAATGGTGGCTGGAGGTGGGGGG + Intergenic
1093812245 12:23505173-23505195 AGATGAAGCCTCCAGGTAGCTGG - Intergenic
1093919133 12:24839672-24839694 AGATGGCTGGTGCAGGAAGGTGG - Intronic
1094435905 12:30420389-30420411 AGATGGAGGATGAAGGGAGGTGG - Intergenic
1094593317 12:31841632-31841654 AGGCGGAGGTTGCAGGGAGGCGG - Intergenic
1094593322 12:31841649-31841671 AGGCGGAGGTTGCAGGGAGGCGG - Intergenic
1095615872 12:44187752-44187774 AGATGGCTGCTTCAGGTAAGGGG + Intronic
1095649302 12:44588079-44588101 AGGTGGAGGTTGCAGGGAGGCGG + Intronic
1095847438 12:46760616-46760638 AAAAGGAGGCTGCAGCTAGTGGG - Intergenic
1096125694 12:49117968-49117990 AGGTGGAGGCTGCAGTGAGCTGG - Intergenic
1096182279 12:49557538-49557560 AGCTGGGGGCTGCAGGCAGTAGG - Exonic
1097120740 12:56729653-56729675 AGGTGGAGGTTGCAGGGAGGCGG + Intronic
1097801945 12:63924069-63924091 AGGTGGAGGTTGCAGGGAGGTGG + Intronic
1098296166 12:69006259-69006281 AGATGAAGCCTCCAGGTAGCAGG - Intergenic
1098712220 12:73777022-73777044 AGATGAAGCCTCCAGGTAAGAGG - Intergenic
1098770519 12:74547006-74547028 AGATGGAGGTTGCAGTGAGCTGG + Intergenic
1098770591 12:74547891-74547913 AGATGGAGGTTGCAGTAAGCCGG - Intergenic
1099102642 12:78460986-78461008 AGATGAAGCCTCCAGGTAGCAGG + Intergenic
1099437089 12:82658121-82658143 AAATGGAGGCTGCAGGAGGAAGG + Intergenic
1099517905 12:83621757-83621779 AGAAGGAGGCTAAAGGTAAGAGG + Intergenic
1099754249 12:86822466-86822488 ACATGCAGGCTGAAGGTAAGTGG + Intronic
1099761186 12:86922286-86922308 AGATGAAGCCTCCAGGTAGCAGG + Intergenic
1100319809 12:93480188-93480210 AGGTGGAGGCTGCAGTGAGCCGG - Intronic
1100400450 12:94224835-94224857 AGATGGAGGTTGCAGTGAGCCGG + Intronic
1100929740 12:99593029-99593051 AGATGAAGCCTCCAGGTAGCAGG + Intronic
1100989356 12:100235642-100235664 AGATGGAGGCTGTAGTGAGCCGG - Intronic
1100995693 12:100298634-100298656 AGCTGGAGGTTGCAGGGAGGTGG - Intronic
1101462486 12:104910984-104911006 AGATGAAGCCTCCAGGTAGCAGG - Intronic
1101941744 12:109104429-109104451 AGAGGGAGGTAGCAGATAGGGGG - Intronic
1102351328 12:112194336-112194358 AGATCGAGGCGGCAGGCTGGAGG + Intronic
1102444367 12:112990472-112990494 AGATGAAGCCTCCAGGTAGCAGG + Intronic
1102697653 12:114812711-114812733 AGTTGGAGGCTGCAGTGAGCTGG + Intergenic
1102741450 12:115211105-115211127 AGAAGGAGGCTGCAGGACAGGGG + Intergenic
1103631298 12:122263400-122263422 AGATGGGGGCTGGGGGGAGGTGG - Intronic
1103717784 12:122955779-122955801 AGGTGGAGGCTGCAGTTAGCTGG - Intronic
1104184519 12:126417062-126417084 AGATGGAGGTTGCAGTGAGCTGG + Intergenic
1104588617 12:130066994-130067016 GGAGGGAGGCTGCAGGCAGCTGG + Intergenic
1104748262 12:131223199-131223221 GGTTGGAGGATGCAGGGAGGAGG - Intergenic
1104914047 12:132255514-132255536 AGATGAAGCCTCCAGGTAGCGGG - Intronic
1104971503 12:132532840-132532862 ACAGGGAGGCTGGAGGTGGGTGG + Intronic
1105023238 12:132831426-132831448 AGGTGGAGGCTGCAGTGAGCTGG + Intronic
1105560424 13:21485391-21485413 AGGTGGAGGTTGCAGTTAGTTGG - Intergenic
1105812821 13:24009714-24009736 AGATGAAGCCTCCAGGTAGCAGG + Intronic
1105874625 13:24541147-24541169 AGAGGGAGGCTGGAGGTGTGGGG + Intergenic
1105902411 13:24767157-24767179 AGGTGGAGGCTGCAGTGAGCTGG + Intronic
1106132323 13:26950779-26950801 AGGTGGAGGATGCAGGCAGGTGG - Intergenic
1106536018 13:30643677-30643699 AGGTGGAGGCTGCAGTGAGCCGG - Intronic
1106836264 13:33638568-33638590 AGATGAAGCCTCCAGGTAGCAGG + Intergenic
1107035801 13:35901418-35901440 AGATGGAGGTTGCAGCGAGCTGG + Intronic
1107102323 13:36606920-36606942 AGATGGAGGTTGCAGTGAGCTGG - Intergenic
1107523071 13:41202320-41202342 AGATGGAGGTTGCAGTGAGTTGG + Intergenic
1107531024 13:41282385-41282407 AGATTGAGGCTGCAGTGAGATGG + Intergenic
1108189400 13:47921985-47922007 AGATGGAGGTTGCAGTGAGCCGG + Intergenic
1108390977 13:49947430-49947452 AGATGAAGCCTCCAGGTAGCAGG - Intergenic
1108503399 13:51087881-51087903 AGATGGTGGCTGAAGGCGGGTGG - Intergenic
1108642401 13:52395058-52395080 AGATGGTGACTGCAGGGATGTGG + Intronic
1110226100 13:73121418-73121440 AGGTCGAGGCTGCAGTTAGATGG - Intergenic
1110455226 13:75683927-75683949 AGATGAAGCCTCCAGGTAGCAGG + Intronic
1110928392 13:81184746-81184768 AGATGAAGCCTCCAGGTAGCAGG - Intergenic
1111172158 13:84541545-84541567 AGATGAAGCCTTCAGGTAGCTGG + Intergenic
1111178848 13:84635820-84635842 AGGAGGAGGCTGTAGGTGGGTGG - Intergenic
1111480219 13:88814562-88814584 AGATAAAGGCTCCAGGTAGCAGG + Intergenic
1111585481 13:90278408-90278430 AGCTGGAGGTAGCAGGGAGGCGG - Intergenic
1112265045 13:97915899-97915921 TGATGGAGGCTGCAGTGAGGTGG + Intergenic
1112619492 13:101040134-101040156 AGATGAAGCCTCCAGGTAGCAGG + Intergenic
1112886632 13:104181684-104181706 AGATGAAGACTCCAGGTAGCAGG + Intergenic
1113535649 13:111064337-111064359 AGATGAAGCCTCCAGGTAGCAGG - Intergenic
1113955163 13:114096433-114096455 AGAAGGTGGCTTCAGGCAGGAGG - Intronic
1113971815 13:114197056-114197078 AGATGAAGCCTCCAGGTAGCAGG + Intergenic
1113978880 13:114254917-114254939 AGATGAAGCCTCCAGGTAGCAGG - Intronic
1114080101 14:19196368-19196390 AGATGAAGCCTCCAGGTAGCAGG - Intergenic
1114080198 14:19197237-19197259 AGATGAAGCCTTCAGGTAGCAGG + Intergenic
1114426318 14:22626653-22626675 AGATGAAGTCTTCAGGTAGCAGG - Intergenic
1114565664 14:23630950-23630972 AGATGAAGCCTCCAGGTAGTAGG + Intronic
1114742900 14:25116342-25116364 AGATGAAGCCTCCAGGTAGCAGG + Intergenic
1115105143 14:29751571-29751593 ACATGGAGTTTGTAGGTAGGAGG - Intronic
1115163591 14:30423372-30423394 AAGAGGAGGCTGCAGGAAGGGGG - Intergenic
1115933504 14:38525703-38525725 AGATGAAGCCTCCAGGTAGCAGG + Intergenic
1116009893 14:39339015-39339037 CCATGGAGGTTGCAGGGAGGAGG + Intronic
1117152402 14:52902797-52902819 AGGTGGAGGCTGCAGTGAGCTGG + Intronic
1117442943 14:55777108-55777130 AGGTGGAGGCTGCAGTGAGCTGG + Intergenic
1118264219 14:64279007-64279029 AGATGAAGCCTCCAGGTAGCAGG - Intronic
1118380390 14:65213207-65213229 AGATGAAGCCTCCAGGTAGCAGG + Intergenic
1118780129 14:69002408-69002430 AGATAGAGGCTGGTGGTAGAAGG - Intergenic
1119262420 14:73245639-73245661 AGATGGAGGCTCCAGCTGCGTGG + Exonic
1119274325 14:73339907-73339929 AGATGGAGGCTGCTGGCCTGGGG + Intronic
1119789638 14:77338396-77338418 AGATGAAGCCTCCAGGTAGCAGG - Exonic
1120106945 14:80506908-80506930 AGATGGGGCCTGCTGGGAGGTGG + Intronic
1120206139 14:81589551-81589573 GGATAGAGCCTGCAGGTGGGTGG + Intergenic
1120407309 14:84105246-84105268 AGATGAAGCCTCCAGGTAGCAGG - Intergenic
1121184835 14:91957846-91957868 AGTTGGATGCTGCAGGGAAGTGG - Intergenic
1121377097 14:93422370-93422392 AGATGAAGCCTCCAGGTAGCTGG + Intronic
1121424983 14:93843976-93843998 AGATGAAGCCTCCAGGTAGCAGG + Intergenic
1121591024 14:95109785-95109807 CCATGGAGGCTGCAGATAAGCGG - Intronic
1121889043 14:97572253-97572275 AGATGTAGGCTGAAGGGAGGGGG + Intergenic
1122100114 14:99401835-99401857 TGATGGAAGCTGCAGGTGTGCGG + Intronic
1122207515 14:100155375-100155397 GGATGGAAGCTGTGGGTAGGTGG - Intronic
1122246133 14:100404775-100404797 AGAAGGAGAATGCAGGCAGGAGG - Intronic
1122540448 14:102495142-102495164 AGATGGAGGTTGCAGTGAGCCGG + Intronic
1122640951 14:103158996-103159018 AGATGAAGCCTCCAGGTAGCAGG - Intergenic
1122658079 14:103275070-103275092 AAGTGGAGGGTGGAGGTAGGGGG - Intergenic
1122695654 14:103550939-103550961 AGGTGGCGGCTGCAGGTGGCTGG - Intergenic
1122713126 14:103675253-103675275 AGCTGGAGGTTGCAGCGAGGCGG + Intronic
1122784597 14:104157913-104157935 AGAAGGAGGCTGCAGCTGAGGGG - Exonic
1123061543 14:105596942-105596964 AAATGGGGGCTGCAGGTGGATGG + Intergenic
1202936371 14_KI270725v1_random:91700-91722 AGATGAAGCCTCCAGGTAGCAGG + Intergenic
1123467425 15:20527212-20527234 AGATGGTGTCTGCAGGCAGTGGG + Intergenic
1123493966 15:20804823-20804845 GGGCGGCGGCTGCAGGTAGGCGG + Intergenic
1123550465 15:21373905-21373927 GGGCGGCGGCTGCAGGTAGGCGG + Intergenic
1123650689 15:22473830-22473852 AGATGGTGTCTGCAGGCAGTGGG - Intergenic
1123741098 15:23282672-23282694 AGATGGTGTCTGCAGGCAGTGGG - Intergenic
1123745900 15:23319886-23319908 AGATGGTGTCTGCAGGCAGTGGG + Intergenic
1123888942 15:24756306-24756328 AGATGAAGCCTCCAGGTAGCAGG + Intergenic
1124064249 15:26325095-26325117 AGATGAAGCCTCCAGGTAGCAGG - Intergenic
1124203125 15:27695406-27695428 AGCTGAAGGCTGCAGGGAGGAGG + Intergenic
1124230675 15:27943558-27943580 AGATGAAGCCTCCAGGTAGCAGG - Intronic
1124278172 15:28343203-28343225 AGATGGTGTCTGCAGGCAGTGGG + Intergenic
1124304529 15:28568405-28568427 AGATGGTGTCTGCAGGCAGTGGG - Intergenic
1124533418 15:30524877-30524899 AGATGGTGACTGCAGGCAGTGGG - Intergenic
1124664214 15:31578369-31578391 AGATGAAGCCTTCAGGTAGCAGG - Intronic
1124765239 15:32482768-32482790 AGATGGTGTCTGCAGGCAGTGGG + Intergenic
1126288542 15:47044558-47044580 AGATGAAGCCTCCAGGTAGCAGG - Intergenic
1126611003 15:50529416-50529438 AGTTGGAGGCTGCAGCGAGCTGG + Intronic
1126946046 15:53821695-53821717 AGATGAAGCCTCCAGGTAGCAGG - Intergenic
1127246337 15:57179416-57179438 AGGTGGAGGCTGCAGTGAGCAGG + Intronic
1127572401 15:60257184-60257206 AGGTGGAGGTTGCAGGGAGGCGG - Intergenic
1127609433 15:60622540-60622562 AGGTGGAGGTTGCAGTGAGGCGG + Intronic
1127803823 15:62500266-62500288 AGATGGAGGTTGCAGTGAGCTGG + Intronic
1128043060 15:64592506-64592528 AGGTGGAGGCTGCAGTGAGCTGG + Intronic
1128342256 15:66830707-66830729 AGATAGAGGCTGCAGGGAGCTGG + Intergenic
1128348613 15:66873761-66873783 AGGCGGAGGTTGCAGGGAGGCGG + Intergenic
1128685090 15:69678314-69678336 AGATTAAGCCTCCAGGTAGGAGG + Intergenic
1128745273 15:70110071-70110093 AGAGGGAGGCTGCAGGCAGGTGG - Intergenic
1129176192 15:73841423-73841445 AAAAGCAGGCTGCAGGTAGGCGG - Intergenic
1129236259 15:74225525-74225547 AGATGGAGGTGGAGGGTAGGGGG - Intergenic
1129832741 15:78681412-78681434 GGATGGAGGCAGGAGGCAGGGGG - Intronic
1129965141 15:79728444-79728466 AGAGGGTGGCAGCAGGTATGAGG - Intergenic
1130629286 15:85549984-85550006 AGGTGGAGGCTGCAGTGAGCCGG - Intronic
1130877320 15:88025887-88025909 AGGTGGAGGCTGCAGTGAGCTGG + Intronic
1130877472 15:88027138-88027160 GGATGGATGCTGGAGGTAGCGGG + Intronic
1130889765 15:88123841-88123863 AGATGAAGCCTCCAGGTAGCAGG + Intronic
1131235774 15:90695908-90695930 AGGTGGAGGTTGCAGTTAGTCGG - Intergenic
1131260578 15:90885378-90885400 AGATGGGGGAGGCAGGGAGGGGG - Intronic
1131465008 15:92647906-92647928 AGATGAAGCCTCCAGGTAGCAGG - Intronic
1131664851 15:94559227-94559249 AGATGGAGGATGCAAGTAATTGG - Intergenic
1131737350 15:95348027-95348049 AAATGCAGACTGCAGCTAGGGGG - Intergenic
1131929407 15:97423127-97423149 AGGTGGAGGCTGCAGTGAGCTGG + Intergenic
1132057704 15:98664593-98664615 AGGTGGAGGTTGGAGGTTGGAGG + Intronic
1202958808 15_KI270727v1_random:101159-101181 GGGCGGCGGCTGCAGGTAGGCGG + Intergenic
1132579289 16:677754-677776 AGAGGGACGCGGCAGGTGGGAGG - Intronic
1132689337 16:1175499-1175521 AGCTGGAGGCTACAGGGTGGAGG - Intronic
1133014200 16:2931544-2931566 AGATTGAGGCTGCAGTGAGCCGG + Intronic
1133028441 16:2998566-2998588 AGAGGGAGGCTGCTGGAAGACGG + Intergenic
1133096086 16:3446909-3446931 AGATGGAGGTTGCAGTGAGCAGG - Intronic
1133247781 16:4460804-4460826 AGGTGGAGGCTGCAGTGAGCTGG + Intergenic
1133292530 16:4732154-4732176 AGGTGGTGGCTCCAGGAAGGAGG - Intronic
1134058354 16:11183814-11183836 AGATGTAGGCTGCAGCGAGCTGG - Intergenic
1134132463 16:11659040-11659062 AGAAGGAGCCTGCAAGGAGGGGG + Intergenic
1134776385 16:16857267-16857289 AGAAGGAGTCTGGAGGGAGGAGG - Intergenic
1135128867 16:19835194-19835216 AGGTGGAGGTTGCAGTGAGGTGG + Intronic
1135236446 16:20760881-20760903 AGATGAAGCCTCCAGGTAGCAGG - Intronic
1135471350 16:22734307-22734329 AGATGGAGACAGGAGGTAAGGGG + Intergenic
1135638297 16:24097903-24097925 AGATGAAGCCTCCAGGTAGCAGG + Intronic
1135781184 16:25302090-25302112 AGATGGAGGTTGCAGTGAGCTGG + Intergenic
1135912568 16:26574805-26574827 AGATGAAGCCTCCAGGTAGCAGG - Intergenic
1136278610 16:29193876-29193898 AGAGGGAGGCAGCAGGTATTTGG + Intergenic
1136503284 16:30685648-30685670 AGGTGGAGGTTGCAGTGAGGCGG - Intergenic
1136539720 16:30922723-30922745 AGATGGCGGCTGCAGGGCCGGGG - Intergenic
1137242603 16:46669595-46669617 AGATGGAGGTTGCAGTAAGCTGG + Intronic
1137302527 16:47166165-47166187 AGATGAAGTCTCCAGGTAGCAGG - Intronic
1137541806 16:49368241-49368263 AGATGAAGTCTCCAGGTAGCAGG - Intergenic
1138008122 16:53355913-53355935 AGATGGTGTCTGCAGGCAGTGGG + Intergenic
1138600461 16:58051140-58051162 AGATGAAGCCTCCAGGTAGCAGG + Intergenic
1139652809 16:68371168-68371190 AGAAGGCGGCTGCACGCAGGAGG - Exonic
1139671256 16:68493519-68493541 CAAGGGAGGCTGCAGGTAGTTGG - Intergenic
1139732656 16:68959934-68959956 AGATGGGTGGTCCAGGTAGGAGG - Intronic
1139848480 16:69936574-69936596 TGATGGTGGCTGCTGGTGGGCGG + Intronic
1140055560 16:71522616-71522638 GAGTGGAGGTTGCAGGTAGGTGG - Intronic
1140470257 16:75209764-75209786 AGGTGGAGGCTGCAAGTGAGCGG + Intergenic
1140989096 16:80190891-80190913 AGGTGGAGGCTGCAGTGAGCTGG + Intergenic
1141411858 16:83840438-83840460 AGATGAAGACTCCAGGTAGCAGG + Intergenic
1141556464 16:84839724-84839746 AGGTGGAGGCTCCCGGTTGGTGG - Intronic
1141757502 16:86001686-86001708 AGGTGGAGGCTGCAGTGAGCTGG + Intergenic
1141792580 16:86246652-86246674 AGATGGGGAAAGCAGGTAGGGGG + Intergenic
1142045370 16:87921935-87921957 AGATTGAGGCTGCAGTTACCTGG - Intronic
1142082998 16:88159957-88159979 AGAGGGAGGCAGCAGGTATTTGG + Intergenic
1142124753 16:88404674-88404696 AGAGGGATGCTGCAGGAAGGAGG + Intergenic
1142754136 17:2005660-2005682 AGGTGGAGGCTGCAGTGAGCTGG + Intronic
1142964776 17:3573625-3573647 ATCTGGAAGCTGCAGGTGGGTGG - Exonic
1142972891 17:3624721-3624743 AGATGGAGGTTGCAGTGAGCCGG - Intronic
1142982475 17:3680051-3680073 AGGTGGAGGATGCAGGGTGGAGG - Intronic
1143495668 17:7311313-7311335 GGAAGGAGGCTGAAGGTAGTAGG - Intronic
1143661172 17:8325412-8325434 ATATGGAGGCTTCAGCTATGAGG - Intergenic
1143887926 17:10079484-10079506 AGATGAAGCCTCCAGGTAGCAGG - Intronic
1144690895 17:17262963-17262985 AGATGGAGGTTGCAGTGAGCCGG - Intronic
1144709918 17:17394698-17394720 ACCTGGTGGCTGCAGGGAGGTGG - Intergenic
1144962078 17:19050177-19050199 AGATGAAGCCTCCAGGTAGCTGG + Intergenic
1144973083 17:19124344-19124366 AGATGAAGCCTCCAGGTAGCTGG - Intergenic
1146146599 17:30424273-30424295 AGATGAAGCCTCCAGGTAGCAGG + Intronic
1147169826 17:38611442-38611464 AGATGGAGGGTGAGGGGAGGGGG + Intergenic
1147341764 17:39756537-39756559 AGAAGGAGGGTGCAGGTGTGGGG + Intergenic
1147423511 17:40334296-40334318 AGAGGGAGGGGGCAGGAAGGGGG - Intronic
1147456664 17:40542290-40542312 AGATGGAGGCGGAAAGGAGGGGG - Intergenic
1147949078 17:44097042-44097064 AGAGGGAGGTGGGAGGTAGGAGG + Intronic
1148043271 17:44725640-44725662 GGATGGAGGCAGAAGGTAGATGG - Intronic
1148606356 17:48932148-48932170 AGATGGAGGCTGCAGTGAGCCGG + Intronic
1148779528 17:50113514-50113536 AGGGGGAGGCTGTAGGAAGGGGG - Intronic
1148929411 17:51116113-51116135 AGATGGAGGTTGCAGTGAGCTGG - Intronic
1148951804 17:51319811-51319833 AGATGAAGCCTCCAGGTAGCTGG + Intergenic
1149172622 17:53830031-53830053 AGATGGAGGTTGCAGTGAGCCGG - Intergenic
1149652165 17:58282255-58282277 GGAAGGTGGCTGAAGGTAGGAGG - Intergenic
1149686664 17:58539488-58539510 AGAGGGAGTCTGCAGGGAGATGG - Intronic
1149920481 17:60654339-60654361 AGGTGGAGGCTGCAGTGAGCCGG - Intronic
1149981722 17:61316234-61316256 AGGTGGAGGCTGCAGTGAGCCGG + Intronic
1150043814 17:61891223-61891245 AGACAGAGGTTGCAGGGAGGAGG + Intronic
1150328818 17:64278193-64278215 AGGTGGAGGCTGCAGTGAGCTGG - Intergenic
1150673162 17:67220105-67220127 ATATGTAGGCTGGAGGCAGGCGG - Intronic
1151021050 17:70617765-70617787 AGATGGAGGTTGGAGGGAGAGGG + Intergenic
1151975173 17:77480412-77480434 GGATGCAGGCTGCAGCCAGGGGG + Intronic
1152005121 17:77675811-77675833 AGATGGAGGAGGGAGGAAGGAGG - Intergenic
1152366807 17:79861126-79861148 AGATGGAGGTTGCAGTAAGCTGG - Intergenic
1203159777 17_GL000205v2_random:38705-38727 AGATGGATGCTCCAGGGATGTGG - Intergenic
1153218884 18:2845710-2845732 AGATGGAGGTTGCAGTGAGCCGG - Intergenic
1153290308 18:3495150-3495172 AGGTGGAGGCTGCAGTGAGCTGG - Intergenic
1153561417 18:6375417-6375439 GGAAGGTGGCTCCAGGTAGGAGG - Intronic
1153633289 18:7092553-7092575 AGGTGGAGGCTGCAGTGAGCTGG + Intronic
1153837533 18:8977350-8977372 AGATGAAGCCTCCAGGTAGCAGG + Intergenic
1153982017 18:10318282-10318304 AGATGAAGCCTCCAGGTAGCAGG - Intergenic
1154097244 18:11430011-11430033 TGATGGCAGCTGCAGGCAGGGGG - Intergenic
1154292593 18:13122659-13122681 AGATGGGGCCTGCAGGGAGTTGG + Intronic
1154489261 18:14907065-14907087 AGATGAAGGCTTCAGGCAGTAGG + Intergenic
1155332117 18:24729005-24729027 AGAGTGAGGCTGCAGTTGGGAGG - Intergenic
1155362466 18:25016408-25016430 GGCAGGAGGCTGGAGGTAGGAGG + Intergenic
1156082650 18:33356963-33356985 AGATGAAGCCTCCAGGTAGCAGG - Intronic
1156133228 18:34004010-34004032 AGATGAAGCCTCCAGGTAGCAGG - Intronic
1156244596 18:35285069-35285091 AGATGCTGGCTGCAGCCAGGAGG - Intronic
1157384129 18:47247717-47247739 AGGCGGGGGCTGCAGGTAGGTGG + Intronic
1157671853 18:49537037-49537059 AGATGAAGCCTCCAGGTAGCAGG + Intergenic
1158122888 18:54069912-54069934 AGATGAAGCCTCCAGGTAGCAGG - Intergenic
1158459699 18:57635362-57635384 ATAAGGAAGCTGAAGGTAGGTGG + Intergenic
1158522470 18:58183147-58183169 ACATGGAGGTTGCTGGGAGGAGG + Intronic
1158681237 18:59568925-59568947 AGGTGGAGGTGGCAGGTGGGAGG - Intronic
1159120158 18:64159571-64159593 AGATGGGGGCTGCACGAAAGAGG - Intergenic
1159644296 18:70899043-70899065 AACTGGAGGCTGCAGGAGGGAGG + Intergenic
1159670454 18:71214809-71214831 AGATGAAGCCTCCAGGTAGCAGG + Intergenic
1159764695 18:72474212-72474234 AGCTGGAGGATGCAGGCAAGGGG - Intergenic
1159894023 18:73979845-73979867 AGGAGGAGCCTGCAGGTAGCAGG - Intergenic
1160179066 18:76618817-76618839 AGAGGGAGGCAGCAGGAATGTGG + Intergenic
1160334547 18:78027052-78027074 GGATGGAAGTTGCAGGTATGTGG + Intergenic
1160430031 18:78804659-78804681 AGAGGGAGGCTGCAGGGGGCTGG + Intergenic
1160472078 18:79145342-79145364 AGGTGCAGGCTGCATGTCGGGGG + Intronic
1160472100 18:79145486-79145508 AGGTGCAGGCTGCATGTCGGGGG + Intronic
1160472115 18:79145582-79145604 AGGTGCAGGCTGCATGTCGGGGG + Intronic
1160472123 18:79145630-79145652 AGGTGCAGGCTGCATGTCGGGGG + Intronic
1160472131 18:79145678-79145700 AGGTGCAGGCTGCATGTCGGGGG + Intronic
1160472139 18:79145726-79145748 AGGTGCAGGCTGCATGTCGGGGG + Intronic
1160472146 18:79145774-79145796 AGGTGCAGGCTGCATGTCGGGGG + Intronic
1160472155 18:79145822-79145844 AGGTGCAGGCTGCATGTCGGGGG + Intronic
1160472163 18:79145870-79145892 AGGTGCAGGCTGCATGTCGGGGG + Intronic
1160472172 18:79145918-79145940 AGGTGCAGGCTGCATGTCGGGGG + Intronic
1160472254 18:79146398-79146420 AGGTGCAGGCTGCATGTCGGGGG + Intronic
1160472264 18:79146446-79146468 AGGTGCAGGCTGCATGTCGGGGG + Intronic
1160472273 18:79146494-79146516 AGGTGCAGGCTGCATGTCGGGGG + Intronic
1160510448 18:79450667-79450689 GGCTGGAGGCTGGAGGAAGGTGG + Intronic
1160522602 18:79516599-79516621 TGGTGGAGGCTTCATGTAGGAGG + Intronic
1160951052 19:1667606-1667628 AGATGGATGCTGGAGGTGTGGGG - Intergenic
1160969034 19:1759334-1759356 TGATGGTGGCAGCGGGTAGGGGG - Intronic
1160999482 19:1902684-1902706 AGGTGGAGCTTGCAGGGAGGTGG + Intergenic
1161153404 19:2720968-2720990 AGAAGGCGGCTGCAGGAGGGAGG + Intronic
1161283308 19:3457009-3457031 GGATGGAGGCTGGAGGAGGGAGG - Intronic
1161305814 19:3567008-3567030 AGGTGGAGGTTGCAGGGAGGTGG + Intronic
1161403943 19:4081620-4081642 AGAAGGAGGCGGGAGGGAGGAGG - Intergenic
1161858192 19:6777868-6777890 AGGTGGAGGCTGCAGTGAGTTGG - Intronic
1162073829 19:8171442-8171464 AGGCGGAGGTTGCAGGGAGGCGG + Intronic
1162081459 19:8220287-8220309 AGAGGGAGGCTGAAGGTGGAGGG - Intronic
1162152540 19:8656313-8656335 AGAAGGGGGCTTCAGGGAGGAGG - Intergenic
1162646150 19:12051994-12052016 ATTTGGAGGCTGTAGGAAGGAGG - Intronic
1162751807 19:12833992-12834014 CGCCGGAGGCTGCAGGTACGCGG + Intronic
1162753889 19:12845724-12845746 AGATGGAGGTTGCAGTGAGCCGG - Intronic
1162803415 19:13123491-13123513 AGATGGTGGTTGCAGGGAGAAGG + Intronic
1162875023 19:13614758-13614780 AGGTGGAGGCTGCAGTGAGCAGG + Intronic
1163057379 19:14730801-14730823 AGATGGAGGAGGGAGGGAGGAGG - Intronic
1163212404 19:15850879-15850901 AGATGAAGTCTCCAGGTAGCAGG - Intergenic
1163524767 19:17814036-17814058 AGAGGGAGGCTGCTGGTGGCTGG - Intergenic
1163525373 19:17817723-17817745 AGGTGGAGGTTGCAGGGAGCTGG + Intronic
1163740191 19:19007078-19007100 AGAGAAAGGCTGCCGGTAGGAGG - Intronic
1163807971 19:19411471-19411493 GGGTGGAGGCTGGAAGTAGGTGG + Intronic
1164043709 19:21515008-21515030 AGGTGGAGGCTGCAGTGAGCGGG - Intronic
1164188530 19:22894297-22894319 AAGTGGAGGCTGCAGTTAGACGG - Intergenic
1164709585 19:30345861-30345883 AGCTGGAGGCAGAAGGAAGGAGG + Intronic
1165257168 19:34585075-34585097 AGATGAAGCCTCCAGGTAGCAGG + Intergenic
1165478452 19:36046501-36046523 AGGTGGAGGGGGCAGGTAGCTGG + Intronic
1165553943 19:36613508-36613530 AGGTGGAGGTTGCAGGGAAGCGG - Intronic
1165779412 19:38423454-38423476 AGGTGGAGGCTGCAGTGAGCCGG + Intronic
1165794528 19:38511224-38511246 AGTTGGAGGCTGCAGGGAGCTGG + Intronic
1166037662 19:40180875-40180897 AGATGAAGCCTCCAGGTAGCAGG - Intergenic
1166503723 19:43358866-43358888 TGATGGAGGGAGCAGGGAGGCGG + Intronic
1166506731 19:43375892-43375914 TGATGGAGGGAGCAGGGAGGCGG - Intergenic
1166751487 19:45165819-45165841 AGAGGCAGGCCCCAGGTAGGAGG + Intronic
1166872700 19:45880483-45880505 AGGTGGAGGCTGCAGTGAGCTGG + Intergenic
1166892084 19:46000043-46000065 GGATGGAGGATGCAGGTAGAGGG + Intronic
1167016938 19:46847301-46847323 AGGTGGAGGTTGCAGTGAGGCGG - Intronic
1167045513 19:47046677-47046699 AGAGGAAGGCTGGAGGGAGGGGG + Exonic
1167090193 19:47338765-47338787 AGATGGAGGCTGCAGTGAGCTGG + Intronic
1167148065 19:47694462-47694484 AGGTGGAGGATGGAGGGAGGTGG - Exonic
1167468699 19:49663661-49663683 AGGTGGGGGATGGAGGTAGGTGG - Intronic
1167835855 19:52069141-52069163 AGTTGGAGGTTGCAGTGAGGTGG - Intronic
1168316878 19:55488412-55488434 AGAAAGAGGCTGCAGGGAGGCGG - Intronic
1168519968 19:57042116-57042138 AGATGAAGCCTCCAGGTAGCAGG - Intergenic
1202633051 1_KI270706v1_random:17675-17697 AGGTGGAGGCTGCAGTGAGCCGG - Intergenic
1202684178 1_KI270712v1_random:33792-33814 AGATGGAGCCTCCAGGTAGCAGG - Intergenic
925509613 2:4610879-4610901 AGATGAAGCCTTCAGGTAGCTGG + Intergenic
925607198 2:5671624-5671646 AGATTGAGGCTGCAGTCAGCTGG - Intergenic
925922415 2:8646666-8646688 GCAGGGAGGGTGCAGGTAGGAGG + Intergenic
927256086 2:21042338-21042360 GTATGGAGGATGCAGGCAGGAGG - Intronic
927375967 2:22414823-22414845 AGATGGAGTATGGAGGTAGATGG - Intergenic
927748746 2:25646520-25646542 AGATGAAGCCTCCAGGTAGCAGG - Intronic
928519197 2:32071808-32071830 AGATGAAGCCTCCAGGTAGCAGG + Intronic
928604811 2:32935916-32935938 AGATGAAGCCTCCAGGTAGCAGG - Intergenic
928668408 2:33575245-33575267 AGGTGGAGGCTGCAGTGAGCCGG + Intergenic
928671591 2:33608758-33608780 AGATGAAGCCTTCAGGTAGCAGG - Intergenic
930164194 2:48187687-48187709 AGATGAAGCCTCCAGGTAGCAGG - Intergenic
930285491 2:49422739-49422761 AGATGAAGCCTCCAGGTAGCAGG - Intergenic
930430209 2:51265790-51265812 AGATGCAGCCTCCAGGTAGCAGG + Intergenic
930819479 2:55630982-55631004 AGGTGGAGGTTGCAGGGAGGTGG + Intergenic
930819484 2:55630999-55631021 AGGTGGAGGTTGCAGGGAGGTGG + Intergenic
931020707 2:58041766-58041788 TGATGGAGCCTCCAGGTAGCAGG - Intronic
931601905 2:64012743-64012765 AGCTGGAGGAGGCAGGGAGGAGG - Intronic
931767059 2:65466301-65466323 AGGTGGAGGTTGCAGAGAGGTGG - Intergenic
932142269 2:69290486-69290508 AGATTGAGGCAGGAGGCAGGAGG - Intergenic
932224717 2:70030446-70030468 TGTTGGAGGCTGTAGGAAGGTGG - Intergenic
932777909 2:74539487-74539509 TGATGGAGGGGGCAGGAAGGAGG + Intronic
933301457 2:80545474-80545496 AGTTCGAGGCTGCAGGGAGCTGG + Intronic
933536816 2:83585708-83585730 AGATGAAGCCTCCAGGTAGCAGG - Intergenic
934247542 2:90321060-90321082 AGATGAAGCCTCCAGGTAGCAGG + Intergenic
934261781 2:91481541-91481563 AGATGGAGCCTCCAGGTAGCAGG - Intergenic
934304823 2:91812520-91812542 AGATGAAGCCTCCAGGTAGCAGG - Intergenic
934328434 2:92040230-92040252 AGATGAAGCCTCCAGGTAGCAGG + Intergenic
934466814 2:94270745-94270767 AGATGAAGCCTCCAGGTAGCAGG + Intergenic
934614968 2:95765023-95765045 ATGCGGAGGCTGCAGGAAGGGGG - Intergenic
934645935 2:96059464-96059486 ATGCGGAGGCTGCAGGAAGGGGG + Intergenic
934839338 2:97615554-97615576 ATGCGGAGGCTGCAGGAAGGGGG + Intergenic
935554796 2:104497827-104497849 AGACTGAGGCTGCAGATGGGAGG + Intergenic
937953116 2:127403533-127403555 ACCTGGAGGCTGCAGTTGGGAGG - Intergenic
938100564 2:128495231-128495253 AGATGGAGACTGATGGTGGGAGG - Intergenic
938142103 2:128803136-128803158 AGATGAAGCCTCCAGGTAGCAGG + Intergenic
938606601 2:132899803-132899825 AGATGGAGGCTGCAGTGAGCTGG + Intronic
939095066 2:137825024-137825046 AGTTGGAGGCTGCAGTGAGCTGG - Intergenic
939423077 2:141998858-141998880 AGATGAAGCCTCCAGGTAGCAGG + Intronic
939768891 2:146289830-146289852 AGATGAAGTCTCCAGGTAGAAGG + Intergenic
940219503 2:151337115-151337137 AGATGGTAGCTGTATGTAGGCGG + Intergenic
941529925 2:166655470-166655492 AGATGAGGCCTGCAGGTAGCAGG + Intergenic
941934111 2:170970045-170970067 AGCTGGGGGCTGCAGGTGAGGGG + Intergenic
942028823 2:171937933-171937955 AGATCAAGGCTGCAGTTAGCTGG + Intronic
942294053 2:174500441-174500463 AGATGAAGCCTCCAGGTAGCAGG + Intergenic
942721523 2:178958381-178958403 AGAGGGAAACTGCAGGTATGGGG + Intronic
943657261 2:190522711-190522733 AGATGAAGCCTCCAGGTAGCAGG - Intronic
943750162 2:191502430-191502452 AGATGAAGCCTCCAGGTAGCCGG + Intergenic
944124971 2:196282688-196282710 AGATGAAGCCTCCAGGTAGCAGG + Intronic
944321933 2:198356146-198356168 ACATGGAGCCTGGAGGTTGGAGG + Intronic
945953382 2:216062113-216062135 AGATGGAGGTTGCAGTGAGCTGG - Intronic
946002760 2:216496576-216496598 AGATGGTGGCTGCTGGGAGGTGG + Intergenic
946148550 2:217748920-217748942 AGGAGGAGGCAGCAGGAAGGGGG - Intronic
946378371 2:219327988-219328010 AGATGGAGGGTGCAGCCAGCCGG + Intronic
946617294 2:221523661-221523683 AGATGGAGGTTGCAGTGAGCCGG - Intronic
947189175 2:227484051-227484073 AAATGGAGGGTGGGGGTAGGGGG - Intronic
947226100 2:227841827-227841849 AGATGAAGACTCCAGGTAGCAGG + Intergenic
947417616 2:229914133-229914155 AGGTGGAGGCTGCAGTGAGTCGG + Intronic
948707061 2:239801486-239801508 AGAGGGGGGCTGCGGCTAGGGGG - Exonic
948717922 2:239877479-239877501 AGATGAAGCCTCCAGGTAGCAGG + Intergenic
948995506 2:241576260-241576282 AGTTGAAGGCTGCAGACAGGAGG - Intergenic
1168767029 20:388597-388619 AGATGGGAGTTGCAGGCAGGGGG + Intronic
1168959299 20:1857744-1857766 AGGATGAGGCTGCAGGTTGGGGG + Intergenic
1169135527 20:3194961-3194983 AAAGGCAGGCTGCAGGCAGGTGG - Intronic
1169469796 20:5874334-5874356 AGGTGGAGGCTGCAGTGAGCTGG - Intergenic
1169851231 20:10053719-10053741 TGGTGGAGGCGGCAGGTGGGAGG - Intronic
1170192572 20:13658653-13658675 AGATGATGGCTGGAGCTAGGGGG + Intergenic
1170468429 20:16643979-16644001 AGGTGGAGGCTGCAGTGAGCCGG + Intergenic
1170645894 20:18195539-18195561 AGAAGGAGGCTGCAGTGAGATGG - Intergenic
1170791811 20:19514859-19514881 AGAGGGAGGGAGCAGGGAGGGGG + Intronic
1170930668 20:20767419-20767441 AGATGAAGCCTCCAGGTAGCAGG + Intergenic
1170994219 20:21336390-21336412 AGGTGGAGGCTGCAGTGAGCTGG + Intronic
1171235610 20:23521844-23521866 AGATGAAGCCTCCAGGTAGCAGG + Intergenic
1171721800 20:28570724-28570746 AGATGGGGCCTGCTGGGAGGTGG + Intergenic
1171721834 20:28570850-28570872 AGATGGGGCCTGCTGGGAGGTGG + Intergenic
1171786005 20:29465183-29465205 AGATGGGGCCTGCTGGGAGGTGG + Intergenic
1171862234 20:30411789-30411811 AGATGGGGCCTGCTGGAAGGTGG - Intergenic
1171862250 20:30411852-30411874 AGATGGGGCCTGCTGGGAGGTGG - Intergenic
1172067568 20:32232664-32232686 AGTTGGGGGTTGTAGGTAGGTGG - Intronic
1172240882 20:33411901-33411923 AGAGGAAGGCTTCAGGGAGGAGG - Intronic
1172257714 20:33534387-33534409 AGGTGGAGGCTGCAGCGAGCTGG - Intronic
1172292200 20:33784304-33784326 AGAAGGGGGCTGCAGGGAGATGG - Intronic
1172302201 20:33858066-33858088 AGAGGGAGGCTGGAGCTAGATGG + Intergenic
1172436331 20:34931328-34931350 AGAGAGAGGGTGGAGGTAGGTGG - Exonic
1172566865 20:35937547-35937569 AGATGAAGCCTCCAGGTAGCAGG + Intronic
1172874116 20:38153884-38153906 AGGTTGAGGCTGCAGTTAGCTGG - Intronic
1173430887 20:42986349-42986371 AGGTGGAGGCTGCAGGAAGCTGG - Intronic
1173836886 20:46131827-46131849 AGATGGAGGCTGCAGTGAGCTGG - Intergenic
1173860163 20:46277982-46278004 AGATCCAGGCAGAAGGTAGGGGG + Intronic
1173888133 20:46479795-46479817 AGATGAAGCCTCCAGGTAGCAGG - Intergenic
1173917258 20:46716951-46716973 AGATGGAGGTTGCAGTGAGCCGG + Intronic
1174190454 20:48736710-48736732 TGATGCAGGCTGCAGGGAAGAGG + Intronic
1174296824 20:49551356-49551378 AGATGAAGCCTCCAGGTAGCAGG - Intronic
1174369347 20:50076019-50076041 AGATGGAGGCTGCAGTGAACTGG - Intergenic
1174375066 20:50121065-50121087 GGAGGGAGGCTGCAGGCAGTTGG + Intronic
1174450547 20:50617446-50617468 AGGTGGAGGCTGCAGCAAGCTGG - Intronic
1174739156 20:52995291-52995313 AGATGGACGATGATGGTAGGTGG - Intronic
1175441545 20:58995833-58995855 AGATGGAGGCAGAAAGCAGGGGG - Intronic
1175594783 20:60222326-60222348 AGTTGGGAGCTGCAGGTAGAAGG - Intergenic
1175853373 20:62105506-62105528 AGGTGCAGGCTGCAGGGAGGTGG - Intergenic
1176012790 20:62908787-62908809 AGATCGAGGCTGCAGTGAGCTGG + Intronic
1176057106 20:63154735-63154757 AGAGGGAGGAAGCAGGAAGGAGG - Intergenic
1176149226 20:63580849-63580871 AGATGGTGTCTTCAGGTAGATGG + Intergenic
1176232991 20:64041531-64041553 AGATGGAGCCTGCAGGGCGCTGG + Intronic
1176244697 20:64091883-64091905 AGGTGGGGGCTGCGGGAAGGTGG - Intronic
1176362848 21:6012564-6012586 AGATGAAGCCTTCAGGTAGCAGG + Intergenic
1176444657 21:6810944-6810966 GGGCGGCGGCTGCAGGTAGGCGG - Intergenic
1176587126 21:8597899-8597921 AGATGAAGCCTCCAGGTAGCAGG - Intergenic
1176645271 21:9343555-9343577 AGGTGGAGGCTGCAGTGAGCCGG - Intergenic
1176692586 21:9934031-9934053 AGATGAAGCTTGCAGGTAGCAGG - Intergenic
1176822823 21:13675982-13676004 GGGCGGCGGCTGCAGGTAGGCGG - Intergenic
1176902537 21:14460786-14460808 AGATGAAGCCTCCAGGTAGCAGG - Intergenic
1177157373 21:17513090-17513112 GGGCGGCGGCTGCAGGTAGGCGG - Exonic
1177437359 21:21072983-21073005 AGATAGGGACTGGAGGTAGGAGG - Intronic
1178094535 21:29199308-29199330 AGATGAAACCTCCAGGTAGGAGG - Intronic
1178492359 21:33060840-33060862 GGATGGAGGCTTCAGGCAGAAGG + Intergenic
1178831469 21:36060370-36060392 AGATGGAGGCTGCAGTGGGCGGG + Intronic
1178897374 21:36570251-36570273 AGATGAAGTCTCCAGGTAGCAGG + Intronic
1178955205 21:37015786-37015808 AGGTGGAGGCTGCAGTGAGCTGG - Intronic
1179083110 21:38191670-38191692 TGATGGAGGCTGGAGGTACAAGG - Intronic
1179760670 21:43525981-43526003 AGATGAAGCCTTCAGGTAGCAGG - Intergenic
1180065673 21:45411052-45411074 AGGTGGACGCTGCAGCTGGGCGG + Intronic
1180122694 21:45764583-45764605 AGCTGCAGGCTGAAGGCAGGGGG + Intronic
1180189326 21:46155025-46155047 GGATGGTGGCTGCAGGGTGGGGG + Intronic
1180269957 22:10574896-10574918 AGATGAAGCCTCCAGGTAGCAGG - Intergenic
1180295387 22:10929539-10929561 AGATGGGGCCTGCTGGGAGGTGG + Intergenic
1180413314 22:12636634-12636656 AGATGGGGCCTGCTGGGAGGTGG - Intergenic
1180500576 22:15925447-15925469 AGATGAAGCCTTCAGGTAGCAGG - Intergenic
1180500673 22:15926332-15926354 AGATGAAGCCTCCAGGTAGCAGG + Intergenic
1180587951 22:16909967-16909989 AGATGAAGCCTCCAGGTAGCAGG + Intergenic
1180636981 22:17269379-17269401 AGATGGAGCCTCCCGGTGGGTGG - Intergenic
1181335697 22:22126123-22126145 CGATGGAGGCTGGAGGTAGGAGG + Intergenic
1181632608 22:24159193-24159215 AGATGGGTGGTGCAGGCAGGAGG - Intronic
1181662876 22:24366062-24366084 AGGGGGATGCTGTAGGTAGGTGG + Intronic
1181681788 22:24500427-24500449 AGATGCAGGCTGGAGGGATGTGG - Intronic
1181765942 22:25092301-25092323 GGAAGGAGGCTGCAGGCAGAGGG + Intronic
1181815882 22:25436515-25436537 AGAGGGAGGCTGCCGGGGGGAGG + Intergenic
1181948831 22:26539697-26539719 AGGTCGAGGCTGCAGTTAGCTGG + Intronic
1182053651 22:27332296-27332318 AGATGGAGTCTGCAGGCACAAGG + Intergenic
1182116643 22:27760437-27760459 AGATTGAGGCTGCAGTGAGCTGG + Intronic
1182321826 22:29482665-29482687 AGCTGGAGGCTGCAGGTTTGTGG - Intronic
1182356370 22:29723956-29723978 GGCTGGAGGTGGCAGGTAGGGGG + Intronic
1182501408 22:30750645-30750667 AGATGAAGCCTCCAGGTAGCAGG - Intronic
1182730203 22:32483260-32483282 ATATGGAGGGTGAAGTTAGGTGG + Intronic
1183232278 22:36590495-36590517 GGATGGAGCCTGCAGGGAGGAGG - Intronic
1183264014 22:36814695-36814717 GGCTGGGGGCTGCAGGAAGGTGG + Intronic
1183713650 22:39521044-39521066 AGATGGCGGCGGCAGGGCGGCGG + Exonic
1183803419 22:40187582-40187604 AGGTGGTGGCTTCAGGTGGGGGG + Intronic
1184031720 22:41899032-41899054 CCATGAAGGCTGCAGGGAGGAGG - Intronic
1184115383 22:42418915-42418937 AGCTGGAGGCTGAAGGCAGAGGG - Intronic
1184566933 22:45297733-45297755 AAATGGAGGCTGCAGGAGGTGGG - Intergenic
1185014048 22:48333247-48333269 AGAGTGAGGCTGGAGGGAGGCGG - Intergenic
949091425 3:33968-33990 AGGTTGAGGCTGCAGTTAGCCGG - Intergenic
949488362 3:4563437-4563459 AGATCGAGGCTGCAGTGAGCTGG + Intronic
949491732 3:4595695-4595717 AGCTGGGGGTTGCAGGGAGGTGG + Intronic
949546556 3:5077832-5077854 AGAAGGAGGTTGCAGGGAGGTGG + Intergenic
950155102 3:10716117-10716139 AGATGGAGGCTGCAGACAGTTGG + Intergenic
950185029 3:10939586-10939608 AGAGGGAGGATGGTGGTAGGTGG - Exonic
950278989 3:11689753-11689775 ACACGGAGCCTGCAGGTAGCTGG - Intronic
950516353 3:13468396-13468418 AGGTGGAGGTTGCAGTTAGCTGG + Intergenic
950999303 3:17539275-17539297 AGATGAAGCCTCCAGGTAGCAGG + Intronic
952202258 3:31142723-31142745 AGATGAAGCCTCCAGGTAGCAGG - Intergenic
952255935 3:31695733-31695755 AGAGAGAGGAAGCAGGTAGGAGG - Intronic
953152474 3:40337528-40337550 AGATGGAAACTGCTGGTAGTGGG + Intergenic
953178114 3:40570424-40570446 AGATGAAGCCTCCAGGTAGCAGG + Intronic
953582455 3:44169292-44169314 AGATGGAGGCAGACAGTAGGAGG - Intergenic
953636558 3:44669919-44669941 AGGAGGAGGCTGCAGCTATGGGG + Intergenic
953747839 3:45588604-45588626 AGATGAAGCCTCCAGGTAGCAGG + Intronic
954410906 3:50370469-50370491 AGAGGGGGGCTGGAGGGAGGGGG + Intronic
954533953 3:51344043-51344065 AGGTGGAGGAAGCAGGCAGGAGG + Intronic
954606652 3:51916001-51916023 AGATGGAGGCCCCAGGTAGCAGG - Intergenic
954650088 3:52155772-52155794 AGATGAAGCCTCCAGGTAGCAGG - Intergenic
954830541 3:53417770-53417792 AGATGTTGGCTGAAGGTAAGGGG - Intergenic
955240845 3:57176737-57176759 AGTTGGAGGCTGCAGTGAGCTGG + Intergenic
955293353 3:57713254-57713276 AGGCGGAGGTTGCAGGGAGGCGG - Intergenic
955777172 3:62446276-62446298 AGATGGTGTCTGCGGGTAGGGGG + Intronic
956672724 3:71706291-71706313 AGACTGAGGCTGGAGGTAAGAGG - Intronic
956784557 3:72631634-72631656 AGATGGAGGCTGCATTTGGATGG - Intergenic
957031744 3:75250191-75250213 AGGTTGAGGCTGCAGTTAGCCGG - Intergenic
957229899 3:77499716-77499738 AGGTGGAGGGTGCAGTGAGGCGG - Intronic
958672826 3:97227288-97227310 AGGTGGAGGCTGCAGTGAGCCGG - Intronic
959551720 3:107666911-107666933 GTATGGAGGCTGGGGGTAGGAGG - Intronic
960281339 3:115784328-115784350 GGAGGGAGGGCGCAGGTAGGCGG + Intergenic
961236325 3:125371284-125371306 AGGTGGAGGCTGCAGTGAGCTGG + Intronic
961323051 3:126091584-126091606 AGATGAAGCCTCCAGGTAGCAGG + Intronic
961394090 3:126574128-126574150 AGATGAAGCCTCCAGGTAGCAGG - Intronic
961413140 3:126737730-126737752 GGAAGGATGCTGCAGATAGGGGG + Intronic
961807943 3:129502684-129502706 AGAGGGAAGGGGCAGGTAGGAGG - Intronic
962272382 3:133987351-133987373 AGATGAAGCCTCCAGGTAGCCGG - Intronic
962347091 3:134626202-134626224 ACATGGAGGCTGAAGGTGGGTGG - Intronic
962745812 3:138396609-138396631 GGAAGGAGGCTGGAGGAAGGTGG + Intronic
963051266 3:141146080-141146102 AGAGGGTGGGGGCAGGTAGGGGG - Intronic
963263417 3:143215145-143215167 AGATGGAGATGGCAGGCAGGGGG - Intergenic
963267085 3:143250296-143250318 AGAAGAAGGTTGCAGGGAGGTGG + Intergenic
963876396 3:150480250-150480272 AGATGGAGGTTGCAGTGAGCAGG + Intergenic
964769664 3:160211125-160211147 AGAGGGAGGCAGCAGGGAGCTGG - Intergenic
965969643 3:174538672-174538694 AGATGAAGCCTCCAGGTAGCAGG - Intronic
966695808 3:182789844-182789866 AGTGGGAGGATGAAGGTAGGAGG - Intergenic
966955614 3:184875231-184875253 AAATTGAGGCAGCAGGCAGGAGG - Intronic
967778118 3:193405678-193405700 AGAAGAAGACTGAAGGTAGGTGG - Intronic
967997249 3:195176124-195176146 AGATGGAGGTTGCAGTGAGTTGG - Intronic
968012044 3:195288786-195288808 AGGTGGAGGTTGCAGGGAGCCGG + Intronic
1202741619 3_GL000221v1_random:61513-61535 AGGTGGAGGCTGCAGTGAGCCGG + Intergenic
968381664 4:101712-101734 GGATGGAGTGTGCAGGGAGGGGG - Intergenic
968420696 4:482231-482253 AGATGGAGGTTGCAGTGAGCCGG - Intronic
968764202 4:2459601-2459623 GGATGGAGGCTGCATGGAGCAGG + Intronic
968834445 4:2952871-2952893 AGGTGGAGGTTGCAGTGAGGTGG + Intronic
968955992 4:3719913-3719935 AGCTGGTGGTGGCAGGTAGGGGG - Intergenic
969198982 4:5586601-5586623 AGATGAAGCCTCCAGGTAGCAGG - Intronic
969291531 4:6243104-6243126 AGATGCAGGGAGCAGGTAGGAGG + Intergenic
969334177 4:6497239-6497261 AGATGGAGGTGGCAGGGAAGTGG + Intronic
969667414 4:8568205-8568227 AGATGAAGCCTCCAGGTAGCAGG + Intronic
969918182 4:10510676-10510698 AGATGAAGCCTTCAGGTAGCAGG - Intronic
970205693 4:13653663-13653685 AGATGAAGCCTCCAGGTAGCAGG - Intergenic
970943394 4:21661714-21661736 AGATGGAGGGTGGAGGGTGGGGG - Intronic
971851704 4:31993127-31993149 AGATGAAGCCTCCAGGTAGCAGG + Intergenic
972303236 4:37806077-37806099 AGATGAAGCCTACAGGTAGCAGG - Intergenic
973617216 4:52691107-52691129 AGATGAAGTCTCCAGGTAGCAGG - Intergenic
973971452 4:56217585-56217607 AGATGGAGCCTCCAGATAGCAGG + Intronic
974717885 4:65694181-65694203 AGATGGGGGCTTCATGTAGAGGG - Intergenic
975225413 4:71865599-71865621 AGATGAAGGCTTCAGGTAAAGGG + Intergenic
975240574 4:72052793-72052815 AGATGAAGCCTCCAGGTAGCAGG - Intronic
975797631 4:78025745-78025767 AGATGAAGCCTCCAGGTAGCAGG + Intergenic
976008703 4:80461170-80461192 AGATGAAGCCTCCAGGTAGCAGG + Intronic
976306080 4:83560690-83560712 AGGTGGGGCCTGCAGGGAGGTGG + Intronic
976347403 4:84020592-84020614 AGATGAAGCCTGCATGTAGCAGG - Intergenic
976596818 4:86902635-86902657 AGATGGATGTTGCAGGTAGTAGG - Intronic
976641762 4:87346578-87346600 AGGTGGAGGCCGCAGTTAGCTGG + Intronic
977727678 4:100316159-100316181 AGTTGGAAACTGAAGGTAGGTGG - Intergenic
978455004 4:108879515-108879537 AGGTGGAGGCTGCAGTGAGCCGG - Intronic
979725877 4:123960060-123960082 AGGTGGAGTTTGCAGGGAGGTGG + Intergenic
980122763 4:128744811-128744833 AGATGGAGGTTGCAGTGAGCCGG - Intergenic
980259839 4:130433976-130433998 AGATGAAGCCTCCAGGTAGCAGG - Intergenic
980365169 4:131794243-131794265 AGATGAAGCTTGCAGGTAGCAGG - Intergenic
980571445 4:134625386-134625408 AGATGAAGCCTCCAGGTAGCAGG + Intergenic
980623447 4:135341312-135341334 ACATGGTGGGTGGAGGTAGGGGG + Intergenic
980908795 4:138975381-138975403 AGATGAAGCCTCCAGGTAGCAGG - Intergenic
981490742 4:145336811-145336833 AGATGAAGACTACAGGTAGCAGG - Intergenic
981707081 4:147670968-147670990 AGATGGAGGGTGGGGGGAGGTGG + Intronic
981903274 4:149891173-149891195 AGATGAAGCCTCCAGGTAGCAGG + Intergenic
982009455 4:151092726-151092748 AGATGAAGCCTCCAGGTAGCAGG + Intergenic
982437140 4:155392804-155392826 AGAGGAAGGCGGCAGGCAGGTGG + Intergenic
982570113 4:157038596-157038618 AGATGGAAGCTGCAGTGAGCTGG + Intergenic
983863785 4:172738973-172738995 AGATGAAGCCTCCAGGTAGCAGG + Intronic
983983962 4:174035643-174035665 AGGTGGAGGCTGCAATGAGGTGG - Intergenic
984008276 4:174339918-174339940 AGATGAAGCCTCCAGGTAGTAGG + Intergenic
984611969 4:181851238-181851260 ATATGGAACCTGCAAGTAGGTGG - Intergenic
984675122 4:182538675-182538697 AATTGGAGACTGCAGGGAGGTGG + Intronic
984684131 4:182646670-182646692 AGGTGGAGGCTGCAGTGAGCCGG + Intronic
984947757 4:184983218-184983240 AGGTGGAGGCTGGAGGCTGGAGG - Intergenic
985675555 5:1229731-1229753 AGGTGCAGGCTGGAGGTCGGGGG + Intronic
985777256 5:1851341-1851363 AGGAGGAGGCTGCAGGGAGGAGG - Intergenic
986219330 5:5753409-5753431 AGATGAAGCCTCCAGGTAGCAGG + Intergenic
986827461 5:11537037-11537059 AATTGGAGGCAGCAGGTGGGGGG + Intronic
987647509 5:20693767-20693789 AGTTGGAGGTTGCAGTTAGCCGG - Intergenic
988376903 5:30448405-30448427 AGACGGAGGTTGCAGTTAGCTGG - Intergenic
989564055 5:42883902-42883924 AGATGAAGCCTCCAGGTAGCAGG - Intronic
990080303 5:51904268-51904290 AGGTTGAGGCTGCAGTGAGGTGG + Intergenic
990609689 5:57444788-57444810 AGCTGGAGGCTGCTGGTGGTGGG - Intergenic
990715428 5:58631260-58631282 AAATGGAGGATGGAGGAAGGAGG - Intronic
990763939 5:59161499-59161521 AGATGAAGCCTCCAGGTAGCAGG + Intronic
990860717 5:60323764-60323786 AGAGAGAGGCTGCGGGTGGGGGG - Intronic
990904288 5:60786870-60786892 AGGCGGAGGTTGCAGGGAGGCGG + Intronic
991263656 5:64691845-64691867 AGATGGAGTCTGCTAGTAAGAGG + Intronic
991291406 5:65036641-65036663 AGATGGAGGCTGGTGGCAGAAGG + Intergenic
991314254 5:65282397-65282419 AGATGAAGCCTCCAGGTAGCAGG + Intronic
991426533 5:66498223-66498245 AGGTGGAGGCTGCAGTGAGCTGG + Intergenic
992248640 5:74855263-74855285 AGATGGAGGCTGCAGTGAGCTGG - Intronic
992541904 5:77774430-77774452 AGATGAAGCCTCCAGGTAGCAGG - Intronic
992754893 5:79895004-79895026 GGATGAAGCCTCCAGGTAGGAGG + Intergenic
992897218 5:81255460-81255482 AGATGGTGCCTGCGGTTAGGAGG + Intronic
993264348 5:85704750-85704772 AGATGTAAGAGGCAGGTAGGAGG - Intergenic
993647333 5:90476727-90476749 AGATGTGGGATGCAGGCAGGGGG - Intronic
993652851 5:90542985-90543007 AGATGAAGCCTCCAGGTAGCAGG + Intronic
993722232 5:91333220-91333242 AGATGGAGGTTGCAGTGAGCTGG - Intergenic
994076682 5:95659736-95659758 AGAAGGAGGCAGGAGGCAGGAGG - Intronic
995596870 5:113756720-113756742 AGATGAAGCCTCCAGGTAGCAGG - Intergenic
995741400 5:115359429-115359451 AGATGAAGCCTCCAGGTAGCAGG - Intergenic
996878751 5:128269367-128269389 AGGTGGAAGTTGCAGGGAGGAGG + Intronic
997013174 5:129903780-129903802 TGGTGGACGATGCAGGTAGGAGG + Intergenic
997365036 5:133320179-133320201 AGCTGGAGGCTGCAGCTTTGGGG - Intronic
997475957 5:134142655-134142677 AGGAGGAGGCTGCAATTAGGTGG + Intronic
997914848 5:137913935-137913957 AGGTGGAGGCTGCAGTGAGTCGG - Intronic
998006915 5:138663167-138663189 AGATGGCAGCTGGAGATAGGAGG - Intronic
998032596 5:138884335-138884357 AGATGAAGCCTCCAGGTAGTAGG + Intronic
998206181 5:140158158-140158180 AGGTGGAGGCTGCAGGGAGCTGG + Intergenic
998390052 5:141781571-141781593 ACCTGGAGGCTGCAGGGAGTTGG - Intergenic
998443326 5:142179948-142179970 AGATGGGGGCTGGAGTAAGGGGG - Intergenic
998567946 5:143232696-143232718 AGGTGGAGGCTGCAGTGAGCTGG - Intergenic
998669315 5:144335797-144335819 AGTTGGAGGGTGAAGGCAGGTGG + Intronic
998754977 5:145367841-145367863 AGATGTAGGTTGCAGGTGAGTGG - Intergenic
998762357 5:145446687-145446709 CGATGGAAGCTCCAGGTATGTGG - Intergenic
998790739 5:145764004-145764026 AGATGGAGGTTGCAGAGAGGTGG + Intronic
999286233 5:150395926-150395948 AGATGGAGTCTGGAGCTGGGAGG - Intronic
999638061 5:153643036-153643058 AAAAGCAGGCTGCAGGCAGGAGG + Intronic
999668816 5:153940427-153940449 AGATGAAGCCTCCAGGTAGCAGG - Intergenic
999858488 5:155620548-155620570 CCATGGAGGCTGCAGTTTGGTGG + Intergenic
1000596736 5:163223452-163223474 AGATGGAGGTTGCAGTGAGCTGG - Intergenic
1000657128 5:163893067-163893089 AGATGAAGCCTTCAGGTAGCAGG - Intergenic
1001280359 5:170382159-170382181 AGATGGAGCCTACAGGTGTGTGG - Intronic
1001282464 5:170396746-170396768 AGATGAAGCCTCCAGGTAGCAGG + Intronic
1001700698 5:173704819-173704841 TGAAGGAGGCTGGAGGAAGGAGG + Intergenic
1002320547 5:178372996-178373018 AGATGGAGGTTGCAGTGAGCCGG - Intronic
1002576943 5:180179285-180179307 TGAGGGAGGCTGCAGGGAGAAGG + Intronic
1002761242 6:204076-204098 AGATGGAGGCCACAGGGAAGAGG - Intergenic
1002869646 6:1155585-1155607 AGATGAAGCCTTCAGGTAGCAGG - Intergenic
1002981861 6:2145466-2145488 AGATGGAGGTTGCAGTGAGCTGG + Intronic
1003100840 6:3175423-3175445 AGATGAAGCCTTCAGGTAGCAGG + Intergenic
1003219455 6:4145739-4145761 AGATGGAGGATGGGGGTAGTAGG - Intergenic
1004080285 6:12385983-12386005 AGGTGGAGGCTGCAGTGAGCCGG - Intergenic
1004200889 6:13546923-13546945 AGATGAAGCCTCCAGGTAGGAGG - Intergenic
1004286963 6:14330103-14330125 AGATGGAGCCTGCTGGTTGATGG + Intergenic
1004350581 6:14886988-14887010 AGTTGGAGGCTGCAGGTGCGAGG + Intergenic
1004743079 6:18482071-18482093 AGATGGAGGCAGGAAGAAGGAGG - Intergenic
1004848539 6:19672433-19672455 AGGTGGAGGCTGCAGTGAGCCGG + Intergenic
1005331836 6:24758193-24758215 AGATGAAGCCTCCAGGTAGCAGG + Intergenic
1005491890 6:26354748-26354770 AGATGAAGCCTTCAGGTAGCAGG + Intergenic
1005829478 6:29659040-29659062 AGGCGGAGGTTGCAGGGAGGCGG + Intronic
1005861677 6:29907282-29907304 AGGAGGAGACTGCAGGTTGGGGG + Intergenic
1006388994 6:33747692-33747714 AGGTGGAAGCTGCAGGGAGTGGG + Intergenic
1006820521 6:36890304-36890326 TGCAGGAGGCTGCAGGCAGGGGG - Intronic
1007240523 6:40421576-40421598 AGATGAAGCCTCCAGGTAGCAGG + Intronic
1007299698 6:40857558-40857580 GGATGGAGGCTGCAGGGATGGGG - Intergenic
1007367721 6:41406645-41406667 AGAAGGAGGTTGGGGGTAGGGGG + Intergenic
1007804382 6:44429089-44429111 AGGTGGAGGCTGCAGTGAGCTGG - Intronic
1008305367 6:49892680-49892702 AGGTGGAGGTGGCAGGCAGGGGG - Intergenic
1008476053 6:51937057-51937079 AGATGAAGCCTCCAGGTAGCAGG - Intronic
1008649907 6:53551536-53551558 AGATGAAGCCTCCAGGTAGCAGG - Intronic
1008846128 6:55966446-55966468 GGATGGAGGGTGGAGGTGGGTGG - Intergenic
1009381302 6:63033977-63033999 ATTTGGAGGGAGCAGGTAGGGGG - Intergenic
1009511264 6:64552490-64552512 AGATGAAGGCTCCAGGTAGCAGG - Intronic
1010308195 6:74349656-74349678 AGATGAAGGCTCCAGGTAGCAGG - Intergenic
1011856060 6:91692909-91692931 AGATGGAAGTTGAAGGTAGATGG + Intergenic
1012227244 6:96718238-96718260 GGATGGAGCCTCCAGGTAGCAGG - Intergenic
1013186408 6:107763454-107763476 AGATGGAGGTTGCAGTGAGCCGG - Intronic
1013419214 6:109950917-109950939 AGATGAAGCCTCCAGGTAGCAGG + Intergenic
1013475971 6:110507684-110507706 AGAGGAAGCCTGCAGGTAGTCGG - Intergenic
1013829535 6:114255579-114255601 AGAAGTTTGCTGCAGGTAGGGGG - Intronic
1013888158 6:114996385-114996407 AGATGAAGCCTCCAGGTAGCAGG + Intergenic
1015167178 6:130211161-130211183 AGATGAAGCCTCCAGGTAGCAGG - Intronic
1015275141 6:131376558-131376580 AGGTGGAGGCTGCAGTGAGCCGG - Intergenic
1015406385 6:132841551-132841573 AGATGGAGGTTGCAGTGAGCCGG + Intergenic
1015769769 6:136756533-136756555 AGGCGGAGGTTGCAGGGAGGCGG - Intronic
1015824440 6:137296654-137296676 AGATGAAGCCTCCAGGTAGCAGG - Intergenic
1015986665 6:138891445-138891467 AGATGAAGCCTCCAGGTAGCAGG - Intronic
1016521520 6:144951913-144951935 AGATGAAGCCTGCAGGTAGCAGG - Intergenic
1016565838 6:145452600-145452622 AGACGGAGCTTGCAGGGAGGCGG + Intergenic
1016681106 6:146830322-146830344 AGATGAAGTCTCCAGGTAGCGGG - Intergenic
1016920691 6:149290033-149290055 AGATGAAGCCTCCAGGTAGCAGG + Intronic
1017265221 6:152437079-152437101 AGATAGAGGCTGCAGTGAGCAGG + Intronic
1017306757 6:152927143-152927165 AGAGGGAGGGAGCAGGTGGGAGG + Intergenic
1017775316 6:157676054-157676076 AGGCGGATGCTGCAGGAAGGTGG + Exonic
1017775348 6:157676166-157676188 AGGGGGATGCTGCAGGAAGGTGG + Exonic
1017805284 6:157940485-157940507 AGATGGAGGTTGCAGTGAGCCGG - Intronic
1017836880 6:158186926-158186948 AGATGAAGTCTCCAGGTAGCAGG + Intronic
1017973597 6:159334768-159334790 AGGTGGAGGTTGCAGTTAGCTGG + Intergenic
1018101433 6:160444540-160444562 CTATGGAAGCTGGAGGTAGGAGG - Intronic
1018155589 6:160982593-160982615 AGATGAAGCCTCCAGGTAGCAGG - Intergenic
1018230127 6:161667263-161667285 AGGTGGGGGCTGCAGGGTGGAGG - Intronic
1018483671 6:164217390-164217412 ATTTGGGGGCTGCATGTAGGGGG - Intergenic
1018486918 6:164249964-164249986 AGATGAAGCCTCCAGGTAGCAGG - Intergenic
1018681996 6:166272070-166272092 AGATGGAGGCTGCTAGCTGGAGG - Intergenic
1018712577 6:166507210-166507232 AGATGGAAGGCGCAGGTCGGTGG - Intronic
1018925071 6:168200176-168200198 AGATGCAGGCTCCAGGTAGCAGG - Intergenic
1019041803 6:169112106-169112128 AGATGAAGCCTCCAGGTAGCGGG - Intergenic
1019049253 6:169170475-169170497 TGGTGGAGGCTGCAGGGAGAAGG - Intergenic
1019213726 6:170426460-170426482 AAATTGATGCTGCAGGCAGGGGG - Intergenic
1019484622 7:1283868-1283890 AGATGGAGGTTGCAGTGAGCCGG + Intergenic
1019489380 7:1304598-1304620 AGACGGAGGCTGCAGTGAGCCGG - Intergenic
1019608168 7:1920537-1920559 AGAAGGAGGGTGCAGGTGTGGGG + Intronic
1019665198 7:2248619-2248641 AGTTGGAGGCTGCAGTGAGCTGG - Intronic
1019675248 7:2307720-2307742 GCTTGGAGGCTGCAGGTAGGAGG - Intronic
1019946831 7:4336651-4336673 AGATGAAGCCTCCAGGTAGCAGG + Intergenic
1020363189 7:7352017-7352039 AGATGAAGTCTCCAGGTAGCAGG - Intergenic
1020644319 7:10795711-10795733 AGATGGAGGTTGCAGTGAGCTGG + Intergenic
1022531211 7:31068057-31068079 AGATGGAGAGTACAGGAAGGTGG + Intronic
1022653463 7:32297820-32297842 AGAGAGAGGCCGCAGGGAGGGGG - Intronic
1023204055 7:37729077-37729099 AGCTCGAGGCTGAAGGAAGGGGG + Intronic
1023394776 7:39742661-39742683 GGCTGGAGGCTGCAAGTTGGGGG + Intergenic
1023514799 7:40991245-40991267 AGATGGAGAATGCTGGTTGGTGG + Intergenic
1024276449 7:47680843-47680865 AGATGAAGCCTCCAGGTAGCAGG - Intergenic
1024653493 7:51429146-51429168 AGGTGGAGGCTGCGGATACGGGG + Intergenic
1024723023 7:52159595-52159617 AGGTGGAGCTTGCAGGGAGGCGG + Intergenic
1024723031 7:52159629-52159651 AGGTGGAGCTTGCAGGGAGGCGG + Intergenic
1024928768 7:54647117-54647139 AGATGAAGCCTTCAGGTAGCAGG + Intergenic
1024949083 7:54839694-54839716 AGATGCAGCCTGCAGATGGGAGG - Intergenic
1025478725 7:60957253-60957275 ATATGGACCCTGCAGGTAAGGGG + Intergenic
1025792659 7:64704743-64704765 AGGTGGAGGCTGCAGTGAGCCGG - Intronic
1025843539 7:65174599-65174621 ACATGGACACTGCAGGTGGGGGG - Intergenic
1025879505 7:65521367-65521389 ACATGGACACTGCAGGTGGGGGG + Intergenic
1025893933 7:65681221-65681243 ACATGGACACTGCAGGTGGGGGG - Intergenic
1025957918 7:66196848-66196870 AGATGGAGGTTGCAGTGAGCTGG - Intergenic
1026210103 7:68296481-68296503 AGATGAAGCCTCCAGGTAGCAGG + Intergenic
1026509839 7:71018742-71018764 AGTTGGAGGCTGCAGTGAGCTGG + Intergenic
1026537979 7:71256043-71256065 AGATGAAGCCTCCAGGTAGCAGG - Intronic
1026563076 7:71466643-71466665 AGATGAAGCCTCCAGGTAGCAGG - Intronic
1026656934 7:72264829-72264851 AGATGGTGGAGGCAGGTAGGAGG - Intronic
1026898242 7:74022817-74022839 AGATGGAGCCTGGAGATAGTAGG - Intergenic
1026906426 7:74065542-74065564 AGATGGAGGTTGCAGTGAGCCGG + Intronic
1026907113 7:74068963-74068985 AGATGGAGGCTGTGTGGAGGGGG - Intronic
1026922761 7:74168566-74168588 AGATGGAGGTTGCAGTGAGATGG - Intergenic
1028262780 7:88685644-88685666 AGAAGGAGGATGGAGGAAGGGGG - Intergenic
1028338929 7:89694313-89694335 ATGTGGAGGAGGCAGGTAGGGGG - Intergenic
1028788574 7:94826295-94826317 AGATGAAGCCTCCAGGTAGCAGG - Intergenic
1028889410 7:95970313-95970335 ACGTGGAGGCTGCAGGAGGGTGG - Intronic
1029106719 7:98183294-98183316 AGATGAAGACTCCAGGTAGCAGG - Intronic
1029355438 7:100048412-100048434 AGATGGAGCCTCCAGGCAGCCGG - Intergenic
1029409904 7:100402436-100402458 AGAGGGAGTCTGCAGGTAGCTGG - Intronic
1029500933 7:100929275-100929297 AGATGAAGCCTCCAGGTAGCAGG + Intergenic
1029947822 7:104551964-104551986 AGAAGCAGGCTGGAGGTAGTAGG - Intronic
1030326728 7:108227580-108227602 GGATGAAGGATGCAGGGAGGTGG + Intronic
1030353920 7:108522351-108522373 AGATGAAGGCTCCAGGTAGCAGG - Intronic
1030421313 7:109309964-109309986 AGAGGGAGGCTGCAGGTGGGTGG - Intergenic
1030558138 7:111052330-111052352 AGATCAAGGCTCCAGGTAGCAGG - Intronic
1030682489 7:112448782-112448804 GGCTGGAGGCTTCAGGAAGGTGG + Intronic
1030825821 7:114156370-114156392 AGATGAAGCCTCCAGGTAGCTGG - Intronic
1031424514 7:121589015-121589037 AGATGAAGCCTACAGGTAGCAGG - Intergenic
1031810423 7:126361059-126361081 AGATGAAGCCTCCAGGTAGCAGG + Intergenic
1032091808 7:128915087-128915109 AGGGGGAGGATGGAGGTAGGGGG + Intergenic
1032663951 7:134016302-134016324 AGATCAAGGCTGTAGGTAGATGG + Intronic
1032674295 7:134114239-134114261 AGATGAAGCCTCCAGGTAGCAGG - Intergenic
1033189510 7:139264656-139264678 AGGCGGAGGTTGCAGGGAGGTGG - Intronic
1033425066 7:141236517-141236539 AGATGGAGGCTGCAGGCAGGTGG - Intronic
1033442773 7:141395369-141395391 AGGTTGAGGCTGCAGGGAGCTGG + Intronic
1033647161 7:143314539-143314561 AGGTGGAGGCTGCAGTGAGCTGG - Intergenic
1033771266 7:144555352-144555374 AGATGGGGGGTTCAGGTAGAAGG - Intronic
1034257630 7:149733311-149733333 GCATGGCGGCTGCAGGGAGGAGG - Exonic
1034265756 7:149779900-149779922 TGATGGAAGCAGGAGGTAGGGGG + Intergenic
1034324699 7:150220176-150220198 AGATGGAGGCTACAGTTGGCGGG - Intergenic
1034334682 7:150313473-150313495 AGATGAAGCCTCCAGGTAGCAGG + Intronic
1034415262 7:150961215-150961237 ACAGGGAGGCTGCAGGCATGGGG + Intronic
1034681665 7:152933574-152933596 AGATGAAGCCTCCAGGTAGCAGG - Intergenic
1034768492 7:153749055-153749077 AGATGGAGGCTACAGTTGGCCGG + Intergenic
1034825251 7:154256530-154256552 ATTTGGAGGCTACAGATAGGTGG - Intronic
1035389523 7:158496197-158496219 AGGGGGAGGCTGCAGGGAAGGGG - Intronic
1035389609 7:158496411-158496433 AGGGGGAGGCTGCAGGGAAGGGG - Intronic
1035430568 7:158817302-158817324 AGATGAAGCCTCCAGGTAGCAGG - Intronic
1035831462 8:2699166-2699188 AGATGGTGGTTGCAGTGAGGTGG - Intergenic
1036057949 8:5280754-5280776 AGATGAAGCCTCCAGGTAGCAGG - Intergenic
1036078324 8:5525160-5525182 AGAGGGAGCCAGCAGGTAGAAGG + Intergenic
1036184540 8:6612545-6612567 GGGTGGAGGCTGCAGGGATGAGG - Intronic
1036515122 8:9436780-9436802 AGGTGGAGGCTGCAGTGAGCCGG + Intergenic
1036577635 8:10043080-10043102 AGGTGGAGGTTGCAGACAGGTGG + Intergenic
1036619582 8:10415752-10415774 ACATGGAGGCTGGGGGTTGGGGG - Intronic
1036634787 8:10541408-10541430 AGATGAAGTCTGAAGGTGGGCGG - Intronic
1036636685 8:10555582-10555604 AGATGAAGCCTCCAGGTAGCAGG - Intergenic
1036655624 8:10675261-10675283 AGATGGGGGATGCAGTCAGGTGG + Intronic
1036777484 8:11623610-11623632 TGATGGAGGCAGGAAGTAGGTGG - Intergenic
1037538033 8:19845506-19845528 ATATGGAGTCTGCAGTTAGTGGG + Intronic
1038005977 8:23430822-23430844 TGGTGGAGGCTGCAGGGAGCTGG - Exonic
1038293896 8:26273576-26273598 AGATGAAGCCTCCAGGTAGCAGG - Intergenic
1039125555 8:34197325-34197347 AGATGCAGGAGGCAGGTAAGAGG - Intergenic
1039308653 8:36292459-36292481 AGATGCAGGAGGCAGGTAAGGGG + Intergenic
1039685312 8:39795416-39795438 AGATGAAGCCTCCAGGTAGCAGG - Intronic
1039722211 8:40176369-40176391 AGATGAAGCCTCCGGGTAGGAGG - Intergenic
1039779078 8:40766069-40766091 AGATGGAGGCCGCAGGAGGGAGG - Intronic
1039799374 8:40941030-40941052 AGATGAAGCCTCCAGGTAGCAGG + Intergenic
1039804288 8:40985264-40985286 TGATGGGGGCTGCAGGATGGTGG - Intergenic
1039842204 8:41302267-41302289 AGATGGAAGCTGGATGTAGATGG - Intronic
1040101816 8:43512715-43512737 AGATGCAGGCACCATGTAGGGGG - Intergenic
1040474598 8:47764852-47764874 CGAGGGAGGGTGCGGGTAGGTGG - Intergenic
1040498203 8:47984955-47984977 AGAGGGAGGGAGCAGGAAGGAGG + Intergenic
1040921859 8:52629677-52629699 AGATGAAGCCTCCAGGTAGCAGG - Intronic
1040927835 8:52703301-52703323 AGATGGAATCTGCAGATAGTAGG - Intronic
1041114954 8:54526552-54526574 AGAAGGATGCAGCAGGCAGGAGG + Intergenic
1041148946 8:54911751-54911773 AGGTGGAGGCTGCATGCAGTTGG - Intergenic
1041257320 8:55990374-55990396 AGATGAAGACTTCAGGTAGCAGG + Intronic
1042361214 8:67885303-67885325 AGATGAAGCCTCCAGGTAGTAGG + Intergenic
1042820315 8:72923176-72923198 AGATGAAGCCTTCAGGTAGAAGG + Intronic
1042848888 8:73195594-73195616 AGATGGAGGTTGCAGCTAGCTGG + Intergenic
1042933497 8:74035710-74035732 AGATGAAGCCTCCAGGTAGCAGG - Intergenic
1042979058 8:74505491-74505513 AGATGAAGCCTCCAGGTAGCTGG - Intergenic
1043535298 8:81196673-81196695 AGATGAAGCCTCCAGGTAGCAGG - Intergenic
1043920755 8:85980675-85980697 AGATGGAGGCTGTAGTGAGCTGG - Intergenic
1043947903 8:86275087-86275109 AGATGAAGCCTCCAGGTAGCAGG + Intronic
1043948639 8:86282789-86282811 AGATGAAGCCTCCAGGTAGGAGG + Intronic
1044031431 8:87242381-87242403 AGATGAAGCCTCCAGGTAGCAGG - Intronic
1044211932 8:89560758-89560780 AGATGAAGCCTCCAGGTAGCAGG + Intergenic
1044309458 8:90676898-90676920 AGATGAAGCCTCCAGGTAGCAGG + Intronic
1044450963 8:92335558-92335580 GGCTGGAGGCTGCAGCTGGGAGG + Intergenic
1044593831 8:93939863-93939885 AGATGAAGCCTCCAGGTAGTAGG + Intergenic
1045109093 8:98922365-98922387 ATAAGAAGGCTGGAGGTAGGTGG - Intronic
1045110816 8:98938543-98938565 AGATTGAGGCAGCAGGAAGCAGG + Intronic
1045332008 8:101163278-101163300 AGATGAAGGCTCCAGGTAGCAGG + Intergenic
1045368439 8:101497272-101497294 AGATGGTAGCTGAAGGTAGTAGG - Intronic
1045644239 8:104284570-104284592 AGATGAAGCCTCCAGGTAGCAGG + Intergenic
1045660666 8:104434266-104434288 AGATGAAGCCTCCAGGTAGCAGG + Intronic
1045736444 8:105301225-105301247 AGATTGAGGCTACAGTGAGGAGG - Intronic
1046178093 8:110605932-110605954 TGATGGAGGGACCAGGTAGGAGG + Intergenic
1046334008 8:112758280-112758302 AGGTGGAGGCTGCAGTGAGCAGG + Intronic
1046444480 8:114299086-114299108 AGATGGAGGTTGCAGTGAGCCGG - Intergenic
1046964687 8:120151082-120151104 AGATGGTGGCTGCACGCTGGGGG + Intronic
1047005251 8:120613279-120613301 AGGTGGAGGCTGCAGTGAGCCGG + Intronic
1047055168 8:121155830-121155852 AGATGAAGCCTCCAGGTAGCAGG - Intergenic
1047113927 8:121819408-121819430 AGATGAAGCCTCCAGGTAGCAGG + Intergenic
1047280240 8:123439246-123439268 AGATGGAGGTTGCAGTGAGCTGG - Intronic
1048621466 8:136137502-136137524 AGATGAAGCCTTCAGGTAGCAGG - Intergenic
1048777912 8:137967831-137967853 AGATGAAGCCTGCAGGTAGCAGG - Intergenic
1048791951 8:138112453-138112475 AGATAGAGGATGGAGGGAGGAGG - Intergenic
1049248907 8:141577767-141577789 AGGTGGAGGCTGCTTGGAGGAGG + Intergenic
1049250542 8:141586515-141586537 AGATGAAGGCTCCAGGTAGCAGG + Intergenic
1049386547 8:142345640-142345662 AGGTGGGAGCTGCAGGGAGGAGG - Intronic
1049454402 8:142679755-142679777 AGATGAAGCCTCCAGGTAGCAGG + Intronic
1049460453 8:142725020-142725042 AGATGAAGCCTCCAGGTAGCAGG - Intergenic
1049467603 8:142759220-142759242 AGATGAAGCCTCCAGGTAGCAGG - Intergenic
1049643047 8:143723989-143724011 AGGTGGAGGGTGCAGGCAGGAGG + Exonic
1049717260 8:144098880-144098902 AGGTGGAAGCTGCAGCAAGGGGG + Exonic
1049870237 8:144969335-144969357 AGATGAAGCCTCCAGGTAGCAGG - Intergenic
1049959944 9:728701-728723 AGATGAAGCCTCCAGGTAGCAGG - Intronic
1050412411 9:5380870-5380892 AGAGGGAGGGAGCTGGTAGGAGG + Intronic
1050526262 9:6549378-6549400 GAGTGGAGGCTGCAGGGAGGAGG + Intronic
1050666317 9:7940423-7940445 AGATGGATGCTGGGGGAAGGAGG + Intergenic
1050793848 9:9510942-9510964 AGATGGAGGCTGAAAGTAGTGGG + Intronic
1051050531 9:12927292-12927314 AGATGAAGCCTCCAGGTAGCAGG - Intergenic
1051108024 9:13603352-13603374 AGGTGGTGTGTGCAGGTAGGTGG + Intergenic
1051473927 9:17481535-17481557 AGATGTACGCTGCAGTTGGGTGG - Intronic
1051782966 9:20710524-20710546 AGGTGGAGGCTGCAGTGAGCTGG + Intronic
1051796337 9:20875522-20875544 AGGTGGAGGTTGCAGGGAGCTGG + Intronic
1052251741 9:26406708-26406730 AGCTGAGAGCTGCAGGTAGGTGG - Intergenic
1053161829 9:35818739-35818761 AGATGTGGGATGCAGGTAGGTGG + Intronic
1053506309 9:38646285-38646307 AGATGGACCCTGCAGCCAGGTGG - Intergenic
1053629528 9:39920096-39920118 AGATGAAGCTTGCAGGTAGCAGG - Intergenic
1053776239 9:41543451-41543473 AGATGAAGCTTGCAGGTAGCAGG + Intergenic
1053943258 9:43277678-43277700 AGATGAAGCCTCCAGGTAGCAGG + Intergenic
1054214359 9:62330606-62330628 AGATGAAGCTTGCAGGTAGCAGG + Intergenic
1054308115 9:63446778-63446800 AGATGAAGCCTCCAGGTAGCAGG + Intergenic
1054365494 9:64335039-64335061 AGATGAAGCTTGCAGGTAGCAGG - Intergenic
1054406849 9:64770769-64770791 AGATGAAGCCTCCAGGTAGCAGG + Intergenic
1054440473 9:65256235-65256257 AGATGAAGCCTCCAGGTAGCAGG + Intergenic
1054489934 9:65765689-65765711 AGATGAAGCCTCCAGGTAGCAGG - Intergenic
1054673124 9:67824752-67824774 AGATGAAGCTTGCAGGTAGCAGG - Intergenic
1054809758 9:69425462-69425484 AGATGGTGGCTGCAGGCGGCTGG + Intergenic
1055045643 9:71921311-71921333 AGATGAAGCCTCCAGGTAGCAGG - Intronic
1055452941 9:76447083-76447105 AGATTGAGGCTGCAGTGAGCTGG + Intronic
1055962961 9:81837521-81837543 AGATGGAGGTTGCAGTGAGCAGG + Intergenic
1056633990 9:88316749-88316771 AGGTGGAGGCTGCAGTGAGCTGG - Intergenic
1056775266 9:89507702-89507724 AGATGGAGCCTCCAGGTAGCAGG + Intergenic
1056920104 9:90779925-90779947 AGATGAAGCCTCCAGGTAGCAGG + Intergenic
1057469957 9:95348725-95348747 AGATGGAGGTTGCAGTGAGCTGG + Intergenic
1057497725 9:95574160-95574182 AGATGGAACCTGAGGGTAGGAGG - Intergenic
1057580028 9:96279501-96279523 AGATGAAGCCTCCAGGTAGCAGG + Intronic
1058125483 9:101189364-101189386 AGATGAAGCCTCCAGGTAGCAGG + Intronic
1058301096 9:103373812-103373834 AGATGAAGCCTCCAGGTAGCAGG - Intergenic
1058449471 9:105082611-105082633 AGATGAAGACTTCAGGTAGCAGG + Intergenic
1058784904 9:108377457-108377479 AGATGAAGCCTCCAGGTAGCAGG + Intergenic
1059000613 9:110344523-110344545 AGATTGAGGCTGCAGTGATGGGG - Intergenic
1059232030 9:112729494-112729516 AGGTGGAGGCTGCAGTGAGCTGG - Intergenic
1060163245 9:121386587-121386609 AGATGAAGCCTCCAGGTAGCAGG + Intergenic
1060698798 9:125732550-125732572 AGCTGGAGGATGCAGCCAGGTGG - Intergenic
1060930128 9:127484430-127484452 AGGTGGAGGCTGCAGTGAGCAGG - Intronic
1061724222 9:132572717-132572739 AGGAGGAGGCTCCAGGTAGAGGG - Exonic
1061803686 9:133126785-133126807 AGAGGGAGGCAGCAGGCAGACGG + Intronic
1061804026 9:133128272-133128294 AGAGGGAGGCAGCAGGCAGACGG + Intronic
1062008466 9:134253544-134253566 AGGTGGAGGCTGCAGTAAGCTGG + Intergenic
1062481391 9:136754107-136754129 CCATGGAGGATGCAGGCAGGAGG + Intergenic
1062535507 9:137019490-137019512 AGGTGGAGGCTGCAGTGAGCTGG - Intronic
1202779316 9_KI270717v1_random:21204-21226 AGATGAAGCCTCCAGGTAGCAGG + Intergenic
1202802232 9_KI270720v1_random:10514-10536 AGATGGGGCCTGCTGGGAGGTGG + Intergenic
1203524541 Un_GL000213v1:73583-73605 GGGCGGCGGCTGCAGGTAGGCGG + Intergenic
1203446822 Un_GL000219v1:64411-64433 AGATGGGGCCTGCTGGGAGGTGG + Intergenic
1203710253 Un_KI270742v1:91437-91459 AGGTGGAGGCTGCAGTGAGCCGG + Intergenic
1203586378 Un_KI270747v1:7583-7605 AGATGAAGCCTCCAGGTAGCAGG + Intergenic
1203617084 Un_KI270749v1:75614-75636 AGATGAAGCCTCCAGGTAGCAGG - Intergenic
1185655215 X:1678987-1679009 AGATGAAGCCAGCAGGTAGCAGG + Intergenic
1185839617 X:3376448-3376470 AGATGAAGCCTCCAGGTAGCAGG - Intergenic
1186007525 X:5089737-5089759 AGATGAAGCCTCCAGGTAGCAGG - Intergenic
1186152816 X:6693123-6693145 AGATGAAGCCTCCAGGTAGCAGG + Intergenic
1186329715 X:8519087-8519109 AGATGAAGCCTCCAGGTAGCAGG - Intergenic
1186440381 X:9580847-9580869 AGATGTAGCCTCCAGGTAGCAGG + Intronic
1186811955 X:13199032-13199054 AGATGAAGCCTCCAGGTAGCAGG - Intergenic
1186819670 X:13274600-13274622 AATTGGGTGCTGCAGGTAGGTGG - Intergenic
1186830020 X:13380882-13380904 AGATGAAGCCTCCAGGTAGCAGG + Intergenic
1187115865 X:16350049-16350071 AGGCGGAGGCTGCAGGGAGGTGG - Intergenic
1187324624 X:18274909-18274931 AGATGAAACCTGCAGGTAGCAGG - Intronic
1187369035 X:18688974-18688996 AGATGAAGCCTTCAGGTAGCAGG + Intronic
1187389760 X:18878267-18878289 AGGTGGAGGCTGCAGTGAGCTGG - Intergenic
1187505571 X:19875670-19875692 ATATGGAGGGTGGAGGTGGGAGG + Intronic
1187824319 X:23319341-23319363 ACATGGAGGCTGCCTGGAGGTGG - Intergenic
1187913439 X:24131728-24131750 AGGTGGAGGCTGGAAGGAGGAGG - Intergenic
1188375487 X:29423069-29423091 AGATGAAGCCTCCAGGTAGCAGG - Intronic
1188417629 X:29955626-29955648 AGAGGCAGGGTGCCGGTAGGAGG - Exonic
1188757051 X:33975075-33975097 AGGGGGAGGCTGCAGGTGGTTGG + Intergenic
1189100402 X:38183121-38183143 AGATGGAGGCTGCAGTAAGCCGG - Intronic
1189471683 X:41319523-41319545 AGTTGGAGGCTGCAGTGAGCTGG + Intergenic
1189617382 X:42797792-42797814 AGATGTTGTCTGCAGGGAGGTGG + Intergenic
1189705107 X:43751838-43751860 ACATGGAAGATGCAGGTATGAGG + Intergenic
1189725502 X:43964571-43964593 AGATGAAAGCTGTAGGTAAGTGG - Intronic
1189750289 X:44213687-44213709 AGATGAAGGCTCCAGGTAGCAGG + Intronic
1189763429 X:44345030-44345052 AGATGGAGGCGGCAGGAAGAAGG - Intergenic
1189826721 X:44926138-44926160 AGATGGAGGCTGCAGTGAGCTGG - Intronic
1189957096 X:46287109-46287131 AGATGAAGGTTCCAGGTAGCAGG + Intergenic
1190289242 X:48981363-48981385 GGAGGGAGGCTACAGGTAGGAGG + Intronic
1190301775 X:49061139-49061161 AGAAGGAGGCAGGAGGCAGGTGG + Intronic
1190397548 X:50000141-50000163 AGAGAGAGGCTGCAAGCAGGAGG - Intronic
1190569787 X:51769537-51769559 AGAGGAAGGCTTCAGGTAGCAGG - Intergenic
1190581299 X:51894669-51894691 AGAGGGAGGGTGGAGGCAGGAGG - Exonic
1190867024 X:54393342-54393364 AGATGAAGCCTCCAGGTAGCAGG - Intergenic
1191764472 X:64682283-64682305 AGATGGAGGCAGTAGGAAGAAGG + Intergenic
1191889350 X:65925047-65925069 AGATGGAGGCCCCAGCTGGGAGG + Intergenic
1192065564 X:67881093-67881115 AGATGAAGGCTTCAAGTAGCAGG + Intergenic
1192238151 X:69309297-69309319 ACATGGGGGCTGTAGGTGGGTGG + Intergenic
1192456216 X:71278277-71278299 AGGTGGAGGTTGCAGGGAGGTGG + Intergenic
1192732043 X:73810186-73810208 AGATGAAGCCTCCAGGTAGGAGG - Intergenic
1193666781 X:84329107-84329129 AGATGAAGGCTCCAGGTAGTAGG + Intronic
1193709679 X:84863678-84863700 AGATGAAGCCTCCAGGTAGCAGG + Intergenic
1194104613 X:89753398-89753420 AGAGGGAGCCTCCAGGTAGCAGG + Intergenic
1194262225 X:91710441-91710463 AGATGAAGCCTCCAGGTAGCAGG + Intergenic
1194341627 X:92712926-92712948 AGATGAAGCCTCCAGGTAGCAGG - Intergenic
1194483038 X:94450724-94450746 AGATGAAGCCTCCAGGTAGCAGG + Intergenic
1195258728 X:103113126-103113148 AGATGAAGCCTCCAGGTAGCAGG - Intergenic
1196696065 X:118613351-118613373 AGATGCAAGATGCAGGTAGCTGG + Intronic
1196763076 X:119217682-119217704 AGATGGAGCCTCCAGGTAGCAGG + Intergenic
1197041625 X:121943434-121943456 AGATGGAGGCTGCAATTAACTGG + Intergenic
1197653559 X:129091140-129091162 AAATTGCTGCTGCAGGTAGGTGG - Intergenic
1197741049 X:129894325-129894347 AGATTGAGGCTGCAGTAAGCTGG - Intergenic
1197981146 X:132218409-132218431 GGCTGGAGGTTGCAGGTCGGAGG - Intronic
1198123644 X:133620719-133620741 AGATGAAGCCTCCAGGTAGCAGG - Intronic
1198258477 X:134945723-134945745 AGATGAAGCCTCCAGGTAGCAGG - Intergenic
1198276861 X:135102948-135102970 AGATGAAGCCTTCAGGTAGCAGG + Intergenic
1198578050 X:138032503-138032525 AGATGTGGGATGCAGGGAGGGGG + Intergenic
1199307121 X:146279694-146279716 AGGTGGAGGCCCCAGTTAGGAGG + Intergenic
1199336765 X:146627754-146627776 AGATGAAGCCTCCAGGTAGCAGG - Intergenic
1199381023 X:147172753-147172775 AGATGAAGCCTCCAGGTAGCAGG + Intergenic
1199699642 X:150365602-150365624 AGACGGAGGCGGCAGCTCGGAGG + Intronic
1200240621 X:154491212-154491234 AGGCGGAGGTTGCAGGGAGGCGG - Intergenic
1200273866 X:154713374-154713396 AGAGGATGGCTGCAGGGAGGAGG + Exonic
1200293368 X:154892986-154893008 AGATGAAGCCTCCAGGTAGCAGG - Intronic
1200456568 Y:3401177-3401199 AGATGGAGCCTCCAGGTAGCAGG + Intergenic
1200581519 Y:4955274-4955296 AGATGAAGCCTCCAGGTAGCCGG + Intergenic
1200787214 Y:7271759-7271781 AGATGGGGGCTGGGGGTGGGGGG + Intergenic
1201260710 Y:12156546-12156568 AGATGAAGCCTCCAGGTAGCAGG + Intergenic
1201348646 Y:13014220-13014242 AGATGAAGCCTCCAGGTAGCAGG - Intergenic
1201415668 Y:13746594-13746616 AGATGGCGGGTGCAGGTCAGTGG - Intergenic