ID: 905281669

View in Genome Browser
Species Human (GRCh38)
Location 1:36853306-36853328
Sequence ACAAAGGCCCATGGGGTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 299
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 280}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905281669_905281676 -5 Left 905281669 1:36853306-36853328 CCATCCACCCCATGGGCCTTTGT 0: 1
1: 0
2: 1
3: 17
4: 280
Right 905281676 1:36853324-36853346 TTTGTTATGCTTCCGAGGTTAGG 0: 1
1: 0
2: 1
3: 7
4: 100
905281669_905281674 -10 Left 905281669 1:36853306-36853328 CCATCCACCCCATGGGCCTTTGT 0: 1
1: 0
2: 1
3: 17
4: 280
Right 905281674 1:36853319-36853341 GGGCCTTTGTTATGCTTCCGAGG 0: 1
1: 0
2: 0
3: 1
4: 101

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905281669 Original CRISPR ACAAAGGCCCATGGGGTGGA TGG (reversed) Intronic
900597620 1:3489665-3489687 AGAATGGCCCAGGGGGAGGAGGG - Intergenic
901207219 1:7504070-7504092 ACAGAGGCCCTTGGGATGGCAGG - Intronic
901545590 1:9954290-9954312 ACTAAAGCCCAGGAGGTGGAGGG - Intronic
901776438 1:11563474-11563496 ACAAAGGCCCAAGGGGCAGAGGG - Intergenic
902408607 1:16199937-16199959 ACAAAGGCCCTGGGGCAGGAGGG - Intronic
903364600 1:22798244-22798266 ACCAAGGCCCATGGAGAGGCTGG + Intronic
903655350 1:24945877-24945899 ACAAGGGGCCATGGTGGGGAGGG - Intronic
904273960 1:29368290-29368312 ACAAAGTACCATGGACTGGATGG + Intergenic
905281669 1:36853306-36853328 ACAAAGGCCCATGGGGTGGATGG - Intronic
906288614 1:44604541-44604563 GCAAAGGCTCATGGGGTCAAGGG + Intronic
906675601 1:47691357-47691379 ACAAGGGCCTGTTGGGTGGAGGG - Intergenic
907934268 1:59028191-59028213 ACAAAGGCCATGGGGGAGGAGGG + Intergenic
909123922 1:71640911-71640933 ACAGAGGCTTATGGGATGGATGG + Intronic
912392558 1:109314325-109314347 GCAGAGGCCAATGGTGTGGATGG - Exonic
913053710 1:115138802-115138824 GCAAAGGCAGAAGGGGTGGATGG - Intergenic
916051496 1:161039683-161039705 ACAAGGGCCCAGGGGCTGCATGG + Exonic
916555839 1:165893486-165893508 CCAAACGCCCATGGGTGGGATGG - Intronic
916741551 1:167650895-167650917 ACAAAGTGCCATGGACTGGATGG + Intronic
916886083 1:169069637-169069659 TCAAATGCCCATGGGGTCCAGGG - Intergenic
917798646 1:178550989-178551011 ACAAAGGCCCTGGGGCAGGAAGG + Intergenic
918059045 1:181046111-181046133 ACAGAGGCCCATGGAGGGGGTGG - Intronic
918375496 1:183905103-183905125 TCAAAGGCGCATGGTGTGGCAGG + Intronic
918544588 1:185668172-185668194 AAAAATGCCCAAGGGATGGAGGG - Intergenic
920134722 1:203760511-203760533 ACAAAGTCCCTTGGTGGGGATGG - Intergenic
920204264 1:204280430-204280452 AGAGAGGCCCAGTGGGTGGAAGG - Intronic
920844777 1:209584556-209584578 AGAAGGGGCCATGGTGTGGATGG - Intronic
920949837 1:210562384-210562406 ACCAAGGGCCAAGGGGTGGGGGG + Intronic
922390111 1:225132403-225132425 ACACAGACACATGGGGTGGGGGG - Intronic
923336735 1:232977377-232977399 ACACACGCTGATGGGGTGGAAGG - Intronic
1062823067 10:549220-549242 AAAAAGGCCCCTGGGGATGAGGG - Intronic
1063871525 10:10422556-10422578 ACACAGGCCTGAGGGGTGGAGGG - Intergenic
1064111777 10:12545893-12545915 ACAAAGGCCAGTGGCGTGAAAGG + Intronic
1065243078 10:23727802-23727824 ACAAGGGCCCATCGGGAGGTGGG - Intronic
1067200381 10:44165830-44165852 AGTAAAGCCCATGTGGTGGAAGG + Intergenic
1067500797 10:46803629-46803651 AGAAGGGCCCATGGGATGCAAGG - Intergenic
1067593783 10:47536290-47536312 AGAAGGGCCCATGGGATGCAAGG + Intronic
1067640893 10:48044399-48044421 AGAAGGGCCCATGGGATGCAAGG + Intergenic
1067687146 10:48472639-48472661 ACAGAGGCAGATGGGCTGGAGGG - Intronic
1067843231 10:49698562-49698584 ACAAATGCCCTGGGGGTGTAAGG + Intronic
1068324630 10:55468022-55468044 AGAAACGACCATCGGGTGGATGG - Intronic
1069728538 10:70596611-70596633 ACACAGTCCCGTGGAGTGGATGG - Intergenic
1074732608 10:116394203-116394225 ACAAAGGTCCACAGTGTGGAAGG - Intergenic
1076485078 10:130810551-130810573 CCAGAGGCCCATTGGGTAGAAGG + Intergenic
1077167880 11:1151991-1152013 CCTAAGGCACCTGGGGTGGAGGG - Intergenic
1078460552 11:11511907-11511929 ACAAAGCACCATAGAGTGGATGG - Intronic
1079677160 11:23243585-23243607 GCAAAGGTCCATGGGGTCAATGG - Intergenic
1080614309 11:33932832-33932854 TCAAATGCCCATAGGCTGGAGGG - Intergenic
1081733169 11:45385429-45385451 ACACAGGCCCATGTGGTGACTGG - Intergenic
1082561972 11:54628677-54628699 CCAGAGGCCTATGGGGTTGAGGG + Intergenic
1084329839 11:68423873-68423895 AGAAAGCCCCAAGGGCTGGAAGG + Intronic
1084534974 11:69751214-69751236 GCAAAGGCCCTGGGGCTGGACGG + Intergenic
1084571028 11:69959922-69959944 ACAAAGGCCCTGTGGATGGAAGG - Intergenic
1088360938 11:108989458-108989480 ACCAGGGCCCATTGGGTGGTGGG - Intergenic
1089625720 11:119749446-119749468 TCAGAGGCCCAGGGGGAGGACGG - Intergenic
1090025650 11:123165556-123165578 ACAAAGGTCCATGGTGTCCATGG + Intronic
1090211673 11:124925076-124925098 ACAGAGGCCCATGAGGAAGAGGG + Intronic
1090417639 11:126551469-126551491 ATAGAGGCGCATGGGGTGGGGGG - Intronic
1091633534 12:2180277-2180299 GCAAAGGCCAAAGGGGTGGTGGG + Intronic
1091806629 12:3361585-3361607 AAAAGGGCCCATGGTGAGGAGGG - Intergenic
1092025665 12:5237702-5237724 ACAAAGACCCAGAGAGTGGAGGG - Intergenic
1093911337 12:24750621-24750643 ACAAAAGCCCAGGGACTGGAAGG + Intergenic
1094375949 12:29787543-29787565 CCACAGGCCCATGGGTTGGGGGG - Intergenic
1095160317 12:38906707-38906729 ACAAAGGTCCCTGCAGTGGAGGG - Intronic
1095797733 12:46238705-46238727 ATAAAGACCCAAGGGTTGGAAGG + Intronic
1095973649 12:47923972-47923994 AGAAAGGCTCGTGGGCTGGAGGG + Intronic
1096070738 12:48774197-48774219 ACTAAGGCCCATGGGGTATAAGG - Intronic
1097352265 12:58561942-58561964 ACAAAGGCCCTGGGGTGGGAAGG + Intronic
1098339917 12:69441322-69441344 AAAAAGGCCCTTAGGGTAGATGG - Intergenic
1100191175 12:92193598-92193620 TCAGAGGCCAAAGGGGTGGATGG + Intergenic
1100651533 12:96595188-96595210 GCAAAGGGCCATGATGTGGAAGG - Intronic
1101761919 12:107665688-107665710 ACAGAGCCCCCTGGGGTGGCAGG + Intergenic
1101858970 12:108467289-108467311 AGAAAGGCTCATGGGGAGAAGGG - Intergenic
1102488782 12:113276451-113276473 ACAAAGGGGCAGGGGGAGGAAGG + Intronic
1102598992 12:114014433-114014455 ACAATAGCTCATGGGGTGGTGGG + Intergenic
1102947860 12:117005715-117005737 ACAAAGGCAGCTGGAGTGGACGG + Intronic
1103022862 12:117550417-117550439 ACAAAGGCTGTTGGGTTGGAGGG - Intronic
1103067892 12:117915156-117915178 ACAAACTACCATGGGCTGGATGG + Intronic
1103572519 12:121854599-121854621 TCCAAGGCCCATGGGTGGGATGG + Intronic
1104903228 12:132200194-132200216 AAAAGGGTCCCTGGGGTGGATGG - Intronic
1105239865 13:18599313-18599335 ATAACGGACCCTGGGGTGGAAGG - Intergenic
1106231013 13:27821097-27821119 CAAAAGGCCCATGGGGTGACTGG - Intergenic
1111008132 13:82276352-82276374 AGAAAGGCCCACTGGGTGGGAGG + Intergenic
1111752751 13:92355710-92355732 ACATATGCCCATGCAGTGGATGG - Intronic
1112159179 13:96850496-96850518 ACAAAGTACAATGGGGTTGATGG + Intergenic
1113780784 13:112975944-112975966 ACAAAGGCTCCTGGGGTGGAAGG - Intronic
1114100359 14:19373829-19373851 ATGAAGGCCTGTGGGGTGGAGGG - Intergenic
1116624049 14:47242723-47242745 ACAGGGGCCCATGGAGTGGGTGG - Intronic
1118748387 14:68790049-68790071 GCAAAAGCCGATGGTGTGGAAGG + Exonic
1120844941 14:89117265-89117287 ACAAAGGGGAGTGGGGTGGAGGG - Intergenic
1121463258 14:94098144-94098166 ACAAAGGTCCATGGATTGAATGG + Intronic
1123095623 14:105765790-105765812 ACAGAGAGCCATGGGGTTGAGGG + Intergenic
1123491377 15:20784749-20784771 ATAACGGACCCTGGGGTGGAAGG + Intergenic
1123547879 15:21353840-21353862 ATAACGGACCCTGGGGTGGAAGG + Intergenic
1124023004 15:25940996-25941018 ACAAAGTCCCATAGACTGGAGGG + Intergenic
1125960691 15:43827157-43827179 ACACAGGCCCAGGAGGTCGAGGG + Intronic
1127342373 15:58061134-58061156 ACATAGGCCCATGTAGTGGAAGG + Intronic
1127994400 15:64144683-64144705 ACAAGGGCCAAAGGGGTGAAAGG - Intronic
1128110882 15:65075304-65075326 ACAGGAGCCCATGGAGTGGATGG - Intronic
1129688975 15:77702435-77702457 CCCCAGGCCCCTGGGGTGGAGGG - Intronic
1129737034 15:77972294-77972316 CCCAAGGCCCAGGAGGTGGAAGG + Intergenic
1130048973 15:80467700-80467722 TCAAGGCCCGATGGGGTGGACGG - Intronic
1130430799 15:83845031-83845053 GCAAAGGCCCATCGGGGGAATGG - Intronic
1132086118 15:98909632-98909654 GCACAGGCCTGTGGGGTGGAGGG + Intronic
1202956209 15_KI270727v1_random:81070-81092 ATAACGGACCCTGGGGTGGAAGG + Intergenic
1132892318 16:2210377-2210399 CCAGAGGACCAAGGGGTGGAAGG - Intronic
1133702582 16:8322878-8322900 ACTCAGGCCCATGGGGTAGGTGG - Intergenic
1135543877 16:23352962-23352984 ATCAAGGACCATGGGGTGGTGGG - Exonic
1136134890 16:28249711-28249733 ACTAAGGGCCAGGAGGTGGAAGG + Intergenic
1136252170 16:29012501-29012523 ACACAGTTACATGGGGTGGAGGG - Intergenic
1137400295 16:48147604-48147626 ACAAAGGCCCAGAGAGAGGAAGG + Intronic
1139503477 16:67387262-67387284 ACAATGGCAAATGGGGTGGAGGG - Intergenic
1139698187 16:68690151-68690173 TCCAAGGCCCAGGGGGTGGCAGG - Intronic
1143779169 17:9220477-9220499 ACACAGGCCCAAGGGCTGGCAGG + Intronic
1144043690 17:11435688-11435710 CCAAAGGCTCATGGGGTTGCTGG + Intronic
1145004344 17:19328997-19329019 ACAAAGGCTAAGGGGGAGGAGGG - Intronic
1146685919 17:34841644-34841666 ACACTGCCCCATGGGGTGGCAGG - Intergenic
1148014888 17:44514547-44514569 ACAAAAACCCATGGAGTGAAAGG - Intergenic
1148150580 17:45394571-45394593 ACATAGGCCCAAAGGTTGGATGG + Exonic
1148785976 17:50146424-50146446 ACAAGGGCCCTTGGGGGAGATGG - Intronic
1149495267 17:57113456-57113478 GCAAAGGCCCTTGGGCTGGAGGG + Intronic
1150789267 17:68187810-68187832 ACAAAGTGCCATGGACTGGATGG + Intergenic
1151417274 17:73974501-73974523 CCAAAGGGACATGGGATGGATGG - Intergenic
1151816868 17:76475451-76475473 GCAAAGGCCCTGGGGCTGGAAGG - Intronic
1152801428 17:82332638-82332660 ACCCAGGCCCACGGTGTGGACGG + Intronic
1154323499 18:13372902-13372924 ACAAAGGCCCAGATGGTGAACGG - Intronic
1154448968 18:14459461-14459483 ATAACGGACCCTGGGGTGGAAGG + Intergenic
1156085573 18:33396749-33396771 ACAAAAGCCCAGGTAGTGGATGG + Intronic
1156385840 18:36604182-36604204 AGGAAGGCCCATGGGGTGGCTGG - Intronic
1158290174 18:55932102-55932124 ACAAAGGCCCTAAGGCTGGAAGG + Intergenic
1158437439 18:57443267-57443289 ATAAAGGGCCCTGGGGAGGAGGG + Intronic
1159638674 18:70837552-70837574 CCAAAGGAGCATGGGGAGGAAGG - Intergenic
1160001459 18:75028196-75028218 ACAAAGCACCATGGGCTGGGCGG + Intronic
1160356328 18:78230568-78230590 AGAAAGGACCAAGGGGTGCAAGG + Intergenic
1162467198 19:10849349-10849371 GCAAAGGTCCAGGGGATGGAAGG - Intronic
1163503373 19:17688909-17688931 GCAAGGACCCATGGGCTGGATGG - Intergenic
1163670872 19:18627746-18627768 GCAAAGGCCCTGGGGCTGGAAGG - Intergenic
1164564088 19:29313652-29313674 ACAGAGGCTCAGGGGGTGGTGGG - Intergenic
1164964821 19:32473722-32473744 ACAAAGCCACATGGCATGGAGGG + Intronic
1165479264 19:36052486-36052508 ACAAAGGCCCATAGGGCCTATGG - Intronic
1166838546 19:45682277-45682299 GCAAAGGCCCTTGGGCAGGAAGG + Exonic
1167193294 19:48007232-48007254 ACAAAGGCTCATAGAGGGGAAGG + Intronic
925624283 2:5826539-5826561 ACAAAGACCCCTGGGGAGGAAGG - Intergenic
925645247 2:6029310-6029332 ACAAAAGCCCATGAGCTGGGTGG - Intergenic
926429710 2:12773528-12773550 AGAATGGCCAATGGGATGGAAGG + Intergenic
927480361 2:23448960-23448982 AGCAAGGCACATGGGGAGGAAGG + Intronic
929572957 2:43034124-43034146 ACACAATCCCATGGGGTCGACGG - Intergenic
932479214 2:72028605-72028627 ACAAAAGGGCATGGGGTGGGGGG - Intergenic
932902085 2:75711854-75711876 ACAGGAGCCCATGGAGTGGATGG - Intergenic
934717094 2:96550512-96550534 ACAGAGGCCCAGGGAGGGGATGG + Intronic
935707530 2:105870020-105870042 ACAAGGACCCATGTGGTGGTCGG + Intronic
935832918 2:107019164-107019186 ACAAAGCACCATGGAGTGGGTGG + Intergenic
937369289 2:121286429-121286451 ACAGTGGGTCATGGGGTGGAGGG + Intergenic
938479270 2:131646350-131646372 ATGAAGGCCTGTGGGGTGGAGGG + Intergenic
940497976 2:154458091-154458113 TCAATGGCCAATGAGGTGGAAGG - Intergenic
940986774 2:160058825-160058847 CCACAGGCCAATGGGGTGGTGGG + Intronic
945266073 2:207892678-207892700 ACCAATGGCAATGGGGTGGATGG - Intronic
946182050 2:217954766-217954788 GCAAAGGCCCAAGGGGTGGCTGG - Intronic
948040686 2:234899282-234899304 ACAAAGGCCCTGTGGGTGGCTGG - Intergenic
948211298 2:236195214-236195236 ACACAAGCCCCTGGGGTAGAGGG - Intronic
948268668 2:236657113-236657135 GCAGAGGCCCATGGGGATGATGG - Intergenic
1168876715 20:1176937-1176959 ACCAAGGCCCAGGGAGAGGAAGG + Intronic
1169345212 20:4823524-4823546 AAAAAGGCCAAGGGGCTGGAGGG - Intronic
1171272016 20:23824912-23824934 ACATAGATCCATGGGGTTGAGGG - Intronic
1171962560 20:31505240-31505262 TCAAAGGCCTCTGGGGTGGGTGG - Intergenic
1172298003 20:33827238-33827260 ACAAAGGCCCAGAGGTAGGAAGG - Intronic
1173569082 20:44065398-44065420 ACAAAGGCACAGAGGTTGGAAGG + Intronic
1173727940 20:45309751-45309773 AAAGAGGCCCAATGGGTGGATGG - Intronic
1173980177 20:47217919-47217941 ACACTGGCCCAGGGAGTGGAAGG - Intronic
1175789556 20:61732824-61732846 ACACAGGGACATGGGGTGGGGGG - Intronic
1175836664 20:62000366-62000388 AGAAAGGCTGGTGGGGTGGAAGG + Intronic
1176268725 20:64224232-64224254 ACAGAGGCCTATGGGAGGGAGGG - Intronic
1176447251 21:6831066-6831088 ATAACGGACCCTGGGGTGGAAGG - Intergenic
1177544195 21:22535270-22535292 CCAAATGTCCATGGGGTGCATGG - Intergenic
1178946317 21:36950900-36950922 ACAAGGGCCCAGAAGGTGGAAGG - Intronic
1179482469 21:41686922-41686944 ACAAAATCCCATAGGCTGGAAGG - Intergenic
1179542856 21:42094866-42094888 ACAAAGGCCCATGAACTGGGTGG + Intronic
1180245458 21:46544452-46544474 ACAAAGGCCCTGGGTCTGGAGGG - Intronic
1180480393 22:15748786-15748808 ATGAAGGCCTGTGGGGTGGAGGG + Intergenic
1180797698 22:18614826-18614848 AAAAAGGACACTGGGGTGGATGG + Intergenic
1181224019 22:21380434-21380456 AAAAAGGACACTGGGGTGGATGG - Intergenic
1181254613 22:21554383-21554405 AAAAAGGACACTGGGGTGGATGG + Intronic
1182098056 22:27639031-27639053 GCAAAGGCCGAGGGGCTGGACGG + Intergenic
1182149307 22:28017352-28017374 ACAAAGGCCCATGGCCTGGGTGG - Intronic
1182745235 22:32600646-32600668 ACAAAGACCCATAGGAAGGAAGG + Intronic
1182881435 22:33737251-33737273 ACAAAAGCCCATGTGGGGAAGGG - Intronic
1183590082 22:38774964-38774986 AGAAAGGCCGTGGGGGTGGAAGG - Intronic
1184361551 22:44022215-44022237 ACAAAGTTCCATGAGCTGGAGGG - Intronic
1184549232 22:45195662-45195684 ACAAAGGGCGAGGGGGAGGAGGG + Intronic
1184617439 22:45647633-45647655 ACAAAGGCCCAGGGTATGGGTGG + Intergenic
1185370218 22:50457424-50457446 ACAAAGGGCCAGGATGTGGAGGG - Intronic
1185422074 22:50740347-50740369 ACCAAGGCCCAGAGAGTGGAAGG - Intronic
949819831 3:8104053-8104075 ACATAGGATCATGGTGTGGAGGG + Intergenic
949876239 3:8627876-8627898 GCTAAGGCCCAGGGGGAGGAAGG - Intronic
950716480 3:14851063-14851085 ACTAAGGCCCTTGGAGGGGAAGG + Intronic
950769546 3:15300721-15300743 ACAAGGTCCCTTGGGGTTGAGGG + Intronic
951084031 3:18489561-18489583 ACAAAGGCCCCTGGAGGAGATGG + Intergenic
951900275 3:27650745-27650767 ACAAAATCCCATGGGCTGGGTGG - Intergenic
954340047 3:49946133-49946155 ACAAAATACCATGGAGTGGAAGG - Intronic
954436122 3:50497269-50497291 ACTGAGGCCCAGGGGGAGGAGGG + Intronic
954698174 3:52438468-52438490 ATAAAGGCCCCTGGGATAGAGGG - Intronic
955277280 3:57558267-57558289 ACAACAGCCCATGAGGTGGATGG + Intronic
961205023 3:125075064-125075086 ACAAAGACACATGGGGCAGAAGG - Intergenic
961659630 3:128461896-128461918 ACAAAGGCCCTGGGGCTGCAGGG + Intergenic
961779767 3:129314801-129314823 AAAAAGGCCCATGGAATGAAGGG + Exonic
965044098 3:163552402-163552424 ACAGAAGCCCATGGAGTGGGTGG + Intergenic
966645222 3:182238706-182238728 ACAAAGGCTCATGATGTGGGGGG - Intergenic
968089607 3:195892077-195892099 ACAAAGAACCTTGGGCTGGAGGG - Intronic
968507843 4:980013-980035 ACACAGGGCCACGGAGTGGAGGG + Intronic
969130770 4:4989769-4989791 ACAGAGGCCCATGGAGTGTGGGG - Intergenic
969544862 4:7819248-7819270 ACAGAGGCACATGGCGTGGTAGG + Intronic
969924808 4:10575727-10575749 CCCAAGGCCCATGGGGATGATGG + Intronic
972016037 4:34247296-34247318 ACAAAGGCCCATGAACTGGATGG - Intergenic
974469942 4:62305736-62305758 ACCAAGACCAATGGGGTGCAGGG + Intergenic
975618079 4:76267375-76267397 GCAAAGGCCCAATGGCTGGAGGG + Intronic
980628630 4:135406899-135406921 ACAGGAGCCCATGGAGTGGATGG - Intergenic
981195000 4:141909096-141909118 ACAAAATACCATAGGGTGGATGG - Intergenic
984577065 4:181463148-181463170 AAAAAGGGCCATGGGTGGGAGGG - Intergenic
984949564 4:184996869-184996891 ACAGAGGGCAATGGAGTGGAGGG + Intergenic
985578693 5:685500-685522 CCTAAGGCTCATGGGGTGGGAGG + Intronic
986181263 5:5394936-5394958 ACAAAGGTGCATGGTGGGGAAGG + Intergenic
986195499 5:5533726-5533748 ACAAAGGCCCACAGTGTGCAGGG - Intergenic
986723706 5:10578573-10578595 GAGAGGGCCCATGGGGTGGAGGG + Intronic
987103092 5:14609967-14609989 ACAAATGCTCATTGTGTGGAAGG - Intronic
987170806 5:15255486-15255508 CCAAAGCCCCAAGGGGAGGATGG + Intergenic
990976335 5:61564785-61564807 ACAGAGGGCCATGGGGTGTCAGG + Intergenic
990980002 5:61593724-61593746 ACCAAGGCCCCTGGGCTGGCAGG + Intergenic
991974825 5:72175334-72175356 AAAAAGGCACATGGAGTGAAGGG - Intronic
992678735 5:79131890-79131912 ACATAGACCAATGGGGAGGAGGG + Exonic
995653268 5:114396065-114396087 ACAAAGGGCCAAGGGCTGGAGGG - Intronic
995679833 5:114704368-114704390 ACAGGAGCCCATGGAGTGGATGG + Intergenic
996588444 5:125118177-125118199 GCAAAGGCCCATGGCTTTGATGG + Intergenic
997353624 5:133248307-133248329 AGAAAGACCCATGGGATGAATGG - Intronic
997419361 5:133753645-133753667 ACAAAGGCCCAGGGGAGAGAAGG - Intergenic
998059778 5:139110861-139110883 ACAAAGCCCCATGGGCCAGATGG + Intronic
998270663 5:140703528-140703550 AGAAAGGTCTATGGGGTGGCCGG - Intronic
998555179 5:143116334-143116356 ACAATGTACCATGGGTTGGATGG - Intronic
1001520066 5:172385143-172385165 AAAGAGGCCCATGGGGAGGGGGG - Intronic
1001660249 5:173385829-173385851 ACAAAGGCCCTAAGGCTGGAAGG - Intergenic
1001664805 5:173423804-173423826 AGAAAGCTCCCTGGGGTGGATGG + Intergenic
1001672729 5:173487575-173487597 TCAAAGGCCCATGGCCTGGAGGG + Intergenic
1001723215 5:173873775-173873797 ACAAATGCCCATGGGGTTATGGG - Intergenic
1002527826 5:179824611-179824633 TCAAAGACCCCTGGGCTGGAAGG - Intronic
1003578065 6:7315455-7315477 ACAGAAGCCCATGGGGTTGGGGG - Intronic
1005080526 6:21952564-21952586 ACACAAGCACATGGTGTGGAGGG + Intergenic
1005759843 6:28958125-28958147 ACAGGAGCCCATGGAGTGGATGG - Intergenic
1006832405 6:36976778-36976800 CCCCAAGCCCATGGGGTGGATGG + Intronic
1008587494 6:52962713-52962735 ACAGGAGCCCATGGGGTGGGGGG + Intergenic
1015320927 6:131873345-131873367 CAAAAGTCCCATGGGGAGGAAGG + Intronic
1016667222 6:146656184-146656206 AGCAAGGCCCAGTGGGTGGATGG - Intronic
1016936513 6:149452237-149452259 ACCAAAGTCCATAGGGTGGAGGG + Intronic
1017462323 6:154663039-154663061 ACAAGAGCCCTTGGGTTGGAGGG - Intergenic
1017822525 6:158059946-158059968 TCAAAGCCCCATGGGGAGGGAGG - Intronic
1018113398 6:160558749-160558771 AGCAAGGACCCTGGGGTGGAGGG + Intronic
1019280717 7:198613-198635 ACAAAGGCACACGTGGTGCATGG - Intronic
1019443689 7:1060105-1060127 ACAAAATCCCAATGGGTGGAAGG - Intronic
1019479539 7:1260183-1260205 AGAGAGGCCCATCGGGAGGACGG - Intergenic
1019560134 7:1651725-1651747 ACAGAGGACCTTGGGGTGGCAGG + Intergenic
1020458109 7:8397186-8397208 ACAAAGAGCCAGGGGGTGGTTGG - Intergenic
1022687522 7:32610489-32610511 AAAAAGGCCGATGTGGTGGCTGG + Intergenic
1024273033 7:47656712-47656734 ACAAAGTACCATGGACTGGATGG - Intronic
1026429416 7:70328946-70328968 ACTAAGGGCAATGGGGAGGAAGG - Intronic
1029163038 7:98566407-98566429 ATAAAAGCTCATTGGGTGGATGG + Intergenic
1037195787 8:16187450-16187472 ACAAAGCCCCAAGGGGTTGTAGG - Intronic
1038781143 8:30569180-30569202 ACATGGGCCCCTGGGGTTGATGG - Intronic
1038885232 8:31655867-31655889 ACAAAGGGCGGTGGGGAGGATGG + Intronic
1041958681 8:63586096-63586118 TCAAAGGCCCTTGTGGTAGAGGG - Intergenic
1042470619 8:69183389-69183411 ACAAAGGCCCACAGGAAGGAGGG + Intergenic
1048148152 8:131865600-131865622 ACAAAGTACCATGGACTGGATGG - Intergenic
1049132879 8:140864645-140864667 AGAATGACCCATGGGTTGGAAGG - Intronic
1049324946 8:142016970-142016992 ACAAGGGCCCCGGGGGAGGAGGG + Intergenic
1050201748 9:3152135-3152157 ACACGGGGCCAGGGGGTGGATGG + Intergenic
1052985312 9:34482844-34482866 ACAAGAGCCCATGGAGTGGGTGG + Intronic
1053137793 9:35662566-35662588 ACACTGGGCCATGGGGTAGAGGG + Exonic
1054996866 9:71401277-71401299 ACAAACACACGTGGGGTGGAAGG + Intronic
1056953435 9:91063876-91063898 AAAATGGGCCCTGGGGTGGAGGG + Intergenic
1057383886 9:94591224-94591246 ACAGGAGCCCATGGAGTGGATGG + Intronic
1057598603 9:96437755-96437777 ACAAAGGCCCATAGGCTGGGGGG + Intergenic
1057793144 9:98137361-98137383 ACTAAGGCCCATAGAGAGGAGGG + Intronic
1058797356 9:108511602-108511624 GCAAAGGCCCATGGAGAGAAAGG - Intergenic
1058973010 9:110100479-110100501 ACAAAGGCCTTTGTGGGGGAAGG - Intronic
1060055082 9:120406396-120406418 ACAAAGGCCCAGAGAGTGGATGG - Intronic
1061250819 9:129425359-129425381 GCAAAGGCCCAGGGGCTGGATGG - Intergenic
1061670408 9:132185228-132185250 ACAGAGGCCCAGGGTGGGGAAGG - Intronic
1061920901 9:133781798-133781820 ACACAGGCCCCTGGGGAGAATGG + Intronic
1062099391 9:134720309-134720331 ACAAAGGGCCAGGGGCTGGTGGG - Intronic
1062219093 9:135404705-135404727 ACAAATCCCCAGGGAGTGGAGGG - Intergenic
1062272608 9:135716765-135716787 GGAAAGGCCCATGGGGTACAGGG + Intronic
1203521939 Un_GL000213v1:53465-53487 ATAACGGACCCTGGGGTGGAAGG + Intergenic
1186083269 X:5956751-5956773 ACAAATGCCCAGTGAGTGGAGGG - Intronic
1187302032 X:18059928-18059950 TCAAAAGCCTATGGGTTGGATGG - Intergenic
1190369342 X:49726633-49726655 ACAATGGCCCCTAGGGTGGTGGG - Intergenic
1190958830 X:55225327-55225349 ATAAAAGCCCATGGGGAGCAGGG + Intronic
1191978695 X:66902083-66902105 ACAAAGGACAATGGGGTTGGAGG + Intergenic
1192236359 X:69298676-69298698 ACTAAGGCCCAGGGGGAGGAAGG + Intergenic
1192261413 X:69507806-69507828 AAACAGGGCCATGGGGTTGAAGG - Intronic
1193585115 X:83311627-83311649 CCACAGGCCCATGGGGAGTATGG - Intergenic
1195672859 X:107484056-107484078 AGAAACCCCCATGGGGTGGTGGG + Intergenic
1195901002 X:109797183-109797205 ACAAAGGACAATTGGGTGAATGG + Intergenic
1198065982 X:133097238-133097260 GCAAAGGCCCGGGGTGTGGACGG - Intergenic