ID: 905284788

View in Genome Browser
Species Human (GRCh38)
Location 1:36872181-36872203
Sequence CACGCACCTGCTTGAGGATC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 91
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 87}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905284778_905284788 15 Left 905284778 1:36872143-36872165 CCAGCAGACCCCAGTCATCTGTC 0: 1
1: 0
2: 0
3: 13
4: 201
Right 905284788 1:36872181-36872203 CACGCACCTGCTTGAGGATCTGG 0: 1
1: 0
2: 0
3: 3
4: 87
905284781_905284788 7 Left 905284781 1:36872151-36872173 CCCCAGTCATCTGTCCCGGTGGC 0: 1
1: 0
2: 1
3: 8
4: 113
Right 905284788 1:36872181-36872203 CACGCACCTGCTTGAGGATCTGG 0: 1
1: 0
2: 0
3: 3
4: 87
905284784_905284788 -7 Left 905284784 1:36872165-36872187 CCCGGTGGCCAGCACTCACGCAC 0: 1
1: 0
2: 0
3: 4
4: 124
Right 905284788 1:36872181-36872203 CACGCACCTGCTTGAGGATCTGG 0: 1
1: 0
2: 0
3: 3
4: 87
905284785_905284788 -8 Left 905284785 1:36872166-36872188 CCGGTGGCCAGCACTCACGCACC 0: 1
1: 0
2: 1
3: 12
4: 162
Right 905284788 1:36872181-36872203 CACGCACCTGCTTGAGGATCTGG 0: 1
1: 0
2: 0
3: 3
4: 87
905284782_905284788 6 Left 905284782 1:36872152-36872174 CCCAGTCATCTGTCCCGGTGGCC 0: 1
1: 0
2: 1
3: 4
4: 92
Right 905284788 1:36872181-36872203 CACGCACCTGCTTGAGGATCTGG 0: 1
1: 0
2: 0
3: 3
4: 87
905284783_905284788 5 Left 905284783 1:36872153-36872175 CCAGTCATCTGTCCCGGTGGCCA 0: 1
1: 0
2: 1
3: 10
4: 100
Right 905284788 1:36872181-36872203 CACGCACCTGCTTGAGGATCTGG 0: 1
1: 0
2: 0
3: 3
4: 87

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905284788 Original CRISPR CACGCACCTGCTTGAGGATC TGG Exonic
900195561 1:1373993-1374015 CACTCACCTGCTTGCGTCTCAGG + Exonic
900203180 1:1420312-1420334 CGCGCGCCTGCTGGAGGCTCCGG - Exonic
900569516 1:3351469-3351491 CAGGCACCTGCTCCAGGACCAGG - Intronic
902510325 1:16963382-16963404 CACCCCCCTGCTTGATGCTCTGG - Intronic
905284788 1:36872181-36872203 CACGCACCTGCTTGAGGATCTGG + Exonic
907996164 1:59634870-59634892 CACGTACCAGCTGGATGATCAGG - Intronic
915605292 1:156946655-156946677 GACGCACCTGCATGAAGAGCTGG + Exonic
922873397 1:228921043-228921065 CATGCACTTGCTTCAGGAGCAGG + Intergenic
1063047873 10:2412076-2412098 CACGCATCTGCGTGAGGTCCCGG + Intergenic
1071980551 10:91000750-91000772 CACACCCCTGATGGAGGATCAGG - Intergenic
1072635460 10:97174790-97174812 CACCCAGCTGGTTGAGGAGCAGG + Intronic
1077052035 11:571273-571295 CACCCTCCTTGTTGAGGATCTGG - Intergenic
1077546113 11:3170754-3170776 CAGGCTCCTGCTTGGGGCTCGGG + Intergenic
1085060747 11:73444338-73444360 AAGGCACATGATTGAGGATCTGG - Intronic
1088003311 11:104908873-104908895 GAAGAAGCTGCTTGAGGATCTGG - Intergenic
1090746568 11:129710291-129710313 CCATCACCTGCTGGAGGATCTGG + Intergenic
1091597009 12:1884980-1885002 TGGGCACCTGCTTCAGGATCTGG + Exonic
1091668440 12:2435811-2435833 CTCGCTCCTGCTTCAGGAGCAGG - Intronic
1096387223 12:51202743-51202765 CACGCACCTGCTTCTGGTTTTGG - Intronic
1098742020 12:74184834-74184856 CATGCCCCTGCTTCAGGAACTGG + Intergenic
1104643224 12:130480452-130480474 CACCCACTTGCTTTAGGACCTGG - Intronic
1106194780 13:27483805-27483827 CAGGCACCTGCTGGAGGGTTGGG - Intergenic
1113417329 13:110138472-110138494 CGCGCACCTGCAGGAGGCTCTGG - Intergenic
1115580408 14:34752490-34752512 CACTCACCTAGTTGAGAATCTGG - Intergenic
1118098499 14:62567538-62567560 CATGCACCTGCTGGAAGAGCAGG + Intergenic
1118329366 14:64803699-64803721 CACGCTGCTCCTTGAGGAACTGG + Exonic
1122789774 14:104179313-104179335 CAAGCACCTGTGTGAGGAGCTGG + Exonic
1126103160 15:45131563-45131585 CAGGGCCCTGCTTGGGGATCAGG - Exonic
1129114228 15:73356291-73356313 CACGCTCCTGCTTGAGTCTCTGG + Intronic
1130083445 15:80756126-80756148 CACCCACCTGATTCAAGATCAGG - Intergenic
1132218206 15:100083721-100083743 CACACAACTGCCTGGGGATCAGG - Intronic
1133100877 16:3478860-3478882 CACTCACCTGGTGGAGGAACAGG + Intronic
1135424412 16:22325251-22325273 CACACACCTGATTGTGCATCCGG - Exonic
1137269377 16:46893575-46893597 CTCGCACCAGCATGAGGGTCAGG - Intronic
1138418996 16:56887078-56887100 ATGGCACCTGCATGAGGATCTGG - Exonic
1139136718 16:64213373-64213395 CATGAACCTGCTTGAGGGCCAGG + Intergenic
1146840274 17:36147680-36147702 GACTCACCTGCTTGGGGATGAGG - Intergenic
1147579760 17:41621655-41621677 CACGCATCTCGTTGAGGATGCGG + Exonic
1149645615 17:58239318-58239340 CACACACCTGCTTGAGAGCCAGG - Intronic
1152982558 18:292614-292636 CAAGCACCTGCTTGAGTGGCTGG - Intergenic
1160824833 19:1074709-1074731 CACGCACCTGCATGAAGGTCTGG - Exonic
1162016504 19:7849315-7849337 CACCTACCTGCATGAGGAGCAGG - Exonic
1162751962 19:12834482-12834504 CACGCACCTGCCTGGCCATCAGG + Intronic
1168309934 19:55455253-55455275 CTCTCACCTGCGTGAGGAGCAGG + Exonic
925298255 2:2792498-2792520 CCTGCCCCTGCTTGAGGAGCTGG + Intergenic
928429457 2:31205670-31205692 CACTCAAGTGCTTGAGGACCTGG + Intronic
930153143 2:48078453-48078475 CCAGCACCTGCTTGAGTTTCTGG + Intergenic
937219880 2:120336641-120336663 TAGGCACCTGCTTGAGGAAATGG + Intergenic
937602013 2:123749082-123749104 CAGGCAGCTGCTTAAGGGTCAGG + Intergenic
948124295 2:235553709-235553731 CCCTCACCTGCTTGAGACTCTGG - Intronic
948838389 2:240637123-240637145 GACGCACCTGCGTGAGAATGAGG + Intergenic
1173827075 20:46054975-46054997 AATGCATCTGTTTGAGGATCTGG - Exonic
1178930233 21:36811880-36811902 CACTCACTTGCTGAAGGATCAGG + Intronic
1179166047 21:38935912-38935934 CACGCACCTGCTTCATGCACCGG + Intergenic
1182547611 22:31085044-31085066 CCCGCACATTCTTGAGGATTGGG + Intronic
1183384338 22:37506302-37506324 CCCGCACCTGCTTGCGGTACTGG + Exonic
1184330972 22:43827507-43827529 CACCCACCTGGTTTAGGATTTGG + Intronic
1185346122 22:50311576-50311598 CACCCACCTGCTTGGGGCTGTGG - Exonic
952791327 3:37202942-37202964 CACACTCCTGTTTGAGCATCTGG - Intergenic
954655422 3:52191398-52191420 CAAGCCCCTGCATGTGGATCAGG + Intergenic
954655460 3:52191532-52191554 CAAGCCCCTGCATGTGGATCAGG - Intergenic
954883018 3:53848429-53848451 TATGCACTGGCTTGAGGATCAGG + Intronic
959547623 3:107615267-107615289 CAGACACCAGCTTGAGCATCTGG + Intronic
970604693 4:17668022-17668044 CATGCACCTGCCTGGGGATAGGG - Intronic
975345208 4:73285416-73285438 CAAGCATTTGGTTGAGGATCTGG + Intergenic
980136354 4:128862198-128862220 CACGCACCTGCGGCAGGACCTGG + Exonic
996930212 5:128877100-128877122 GACGCCCCTGCTTTAGGATCTGG - Intronic
1003979226 6:11374338-11374360 AAAGCACCTGCATGAGGAACAGG + Intronic
1005859864 6:29892076-29892098 CACCCACCTCCCTCAGGATCAGG + Intergenic
1007577569 6:42935843-42935865 CAGGCACATGCATGAGGGTCTGG + Intronic
1007992328 6:46270053-46270075 TGCGGGCCTGCTTGAGGATCTGG + Intronic
1011163948 6:84424980-84425002 CACCCACCTGCACTAGGATCTGG - Intergenic
1015094892 6:129403542-129403564 CACACACCTGCTAGAGCACCTGG + Intronic
1019038283 6:169081112-169081134 CAGGCCCCTGCTTGAGTCTCAGG - Intergenic
1019194901 6:170275377-170275399 CATGCACCTGATCGTGGATCTGG - Intergenic
1033345922 7:140525744-140525766 CACTCACCTGTCTGAGGAACCGG + Exonic
1036601786 8:10267683-10267705 CCCACACCTGCTGGGGGATCAGG + Intronic
1036869999 8:12428780-12428802 CTCGGAGCTGCTCGAGGATCCGG + Exonic
1040828074 8:51645462-51645484 CACACGGCTGCTTGAGGAGCTGG + Intronic
1041201354 8:55453846-55453868 CACGGACCTGTTTGATGAGCTGG - Intronic
1052608140 9:30732311-30732333 CACACACCTACTTGAGCTTCCGG - Intergenic
1053066926 9:35075514-35075536 CACCCACCTGCTTCAGGGCCAGG - Exonic
1058874278 9:109229604-109229626 CACACACCTTCTGGAGGAGCTGG + Intronic
1062536375 9:137022840-137022862 CACGCAGCTGCTTGAGCGCCTGG - Exonic
1062553826 9:137104895-137104917 CACACACCTGCCTGAGGCTGTGG + Intronic
1062592090 9:137278733-137278755 CACGCACCGGCCCGAGGCTCGGG - Exonic
1062629629 9:137458072-137458094 CACGCACATGCTAGAGCTTCAGG - Intronic
1185779098 X:2829718-2829740 CGCGCACCTGCTTGGAGTTCTGG - Intronic
1190526453 X:51333265-51333287 CACGGAGCTGCTGGAGGATTGGG + Exonic
1190542788 X:51496123-51496145 CACGGAGCTGCTGGAGGATTGGG - Exonic
1199717608 X:150517490-150517512 CACACACCTCCCTGGGGATCTGG - Intergenic