ID: 905288678

View in Genome Browser
Species Human (GRCh38)
Location 1:36906200-36906222
Sequence ACATGTGTGGTGCTCCACTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 125
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 116}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905288673_905288678 12 Left 905288673 1:36906165-36906187 CCCCGCAGGGCAGCCGAGAAGAA 0: 1
1: 0
2: 0
3: 9
4: 101
Right 905288678 1:36906200-36906222 ACATGTGTGGTGCTCCACTCAGG 0: 1
1: 0
2: 1
3: 7
4: 116
905288675_905288678 10 Left 905288675 1:36906167-36906189 CCGCAGGGCAGCCGAGAAGAACA 0: 1
1: 0
2: 1
3: 17
4: 192
Right 905288678 1:36906200-36906222 ACATGTGTGGTGCTCCACTCAGG 0: 1
1: 0
2: 1
3: 7
4: 116
905288676_905288678 -1 Left 905288676 1:36906178-36906200 CCGAGAAGAACAGACAACTAGCA 0: 1
1: 0
2: 0
3: 10
4: 194
Right 905288678 1:36906200-36906222 ACATGTGTGGTGCTCCACTCAGG 0: 1
1: 0
2: 1
3: 7
4: 116
905288674_905288678 11 Left 905288674 1:36906166-36906188 CCCGCAGGGCAGCCGAGAAGAAC 0: 1
1: 0
2: 0
3: 12
4: 142
Right 905288678 1:36906200-36906222 ACATGTGTGGTGCTCCACTCAGG 0: 1
1: 0
2: 1
3: 7
4: 116

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905288678 Original CRISPR ACATGTGTGGTGCTCCACTC AGG Intronic
900033813 1:390537-390559 ACATAGGTGGTTCTCCACCCAGG + Intergenic
900054648 1:620427-620449 ACATAGGTGGTTCTCCACCCAGG + Intergenic
900836542 1:5009392-5009414 ACTTGGGTGATGCTGCACTCAGG - Intergenic
901733816 1:11299392-11299414 CCATGTGTGGTGCTCCTGTGCGG - Intergenic
904703672 1:32374718-32374740 ACATCTGCGGTGCTTCACTGAGG - Intronic
905288678 1:36906200-36906222 ACATGTGTGGTGCTCCACTCAGG + Intronic
905532134 1:38688329-38688351 ACATGTGTAGTGATCAAATCAGG - Intergenic
906881893 1:49600761-49600783 ACATGTTTAGTGCTCCCTTCAGG + Intronic
909513512 1:76481838-76481860 AAATGTCTGGGGCTCCACTAGGG + Intronic
914339033 1:146742571-146742593 CCATTTGTTGTTCTCCACTCTGG + Intergenic
920203365 1:204274496-204274518 ACCTGTGGGGTGCACCACCCTGG + Intronic
922166254 1:223117897-223117919 ACATATGTGATTCTCCACACAGG + Intronic
922256169 1:223894693-223894715 ACATAGGTGGTTCTCCACCCAGG + Intergenic
1066756820 10:38720127-38720149 ACATGTGTAGGACTCCACTGGGG - Intergenic
1067751338 10:48973733-48973755 GCATGTGTGGTGGGCCACTTTGG + Intronic
1067999183 10:51311835-51311857 ACAGGTGTGGTGCTTCCCCCAGG - Intronic
1068602315 10:58968752-58968774 ACTTGTGTGGTGATCCCATCTGG - Intergenic
1068658103 10:59594857-59594879 AACTGTGTAGTGATCCACTCAGG - Intergenic
1072841141 10:98775210-98775232 ACATGTGTGTTTCTGCAATCTGG - Intronic
1077391690 11:2303329-2303351 ACATGGCTGATGTTCCACTCAGG + Intronic
1082616094 11:55361413-55361435 ACAGGTGTGTGACTCCACTCTGG + Intergenic
1093088729 12:14896113-14896135 ACTTGTTTGGTGCTCTACCCGGG - Intronic
1098527162 12:71499406-71499428 ACATGTGTGGTTCTCTTCCCTGG - Intronic
1106319423 13:28624203-28624225 ACCTGTGTGTTCCTCCACTGAGG - Intergenic
1116655240 14:47644768-47644790 ACATGTGTAGTGATCAAATCAGG - Intronic
1116815423 14:49579423-49579445 ACATGTGTGAGCCACCACTCTGG - Intronic
1119856181 14:77902933-77902955 TCAAGTGTGGTGCTCCTCTCAGG + Intronic
1122317911 14:100836494-100836516 GCATGTGTGGGGGTCCACCCTGG + Intergenic
1122472190 14:101976724-101976746 ACATGTCTGATGCTACTCTCAGG + Intronic
1124615375 15:31237836-31237858 ACATGTATGGTGATCAAATCAGG + Intergenic
1125944380 15:43701213-43701235 AGATGGCTGGAGCTCCACTCAGG - Intergenic
1128151286 15:65365041-65365063 ACATGGCTGGTCCTCCAGTCTGG - Intronic
1128334995 15:66780089-66780111 AGGTGTGTGCTGCTCCTCTCTGG - Intronic
1130696533 15:86137198-86137220 CCATTTGTGCTGCTCCATTCTGG + Intergenic
1133166005 16:3947722-3947744 ACATGTGTGAGCCTCCACGCTGG + Intergenic
1136725766 16:32356066-32356088 ACATGTGTAGGACTCCACTGGGG + Intergenic
1136844099 16:33562117-33562139 ACATGTGTAGGACTCCACTGGGG + Intergenic
1139995247 16:70974781-70974803 CCATTTGTTGTTCTCCACTCTGG - Intronic
1142072541 16:88099143-88099165 CCATGTGTGGTCCTCCCATCTGG - Intronic
1203000664 16_KI270728v1_random:161688-161710 ACATGTGTAGGACTCCACTGGGG - Intergenic
1203132267 16_KI270728v1_random:1698093-1698115 ACATGTGTAGGACTCCACTGGGG - Intergenic
1203154264 16_KI270728v1_random:1862416-1862438 ACATGTGTAGGACTCCACTGGGG + Intergenic
1146103350 17:30007708-30007730 ACAGGTGTGGGTCACCACTCTGG - Intronic
1149689292 17:58560779-58560801 ACACATGTGGGGCTCCATTCTGG - Intronic
1156369008 18:36456002-36456024 ACATTTGAGGTGCACAACTCGGG - Intronic
1157222002 18:45835029-45835051 AAATGTTAGGTCCTCCACTCGGG + Intronic
927558734 2:24053928-24053950 ACGTGTGTGGTGCACTACACAGG + Exonic
928757854 2:34547382-34547404 AGTTGTGTGGTCCTCAACTCAGG + Intergenic
931389940 2:61832923-61832945 ACAAGTGTCCTGCTCCACTTTGG - Intronic
931490346 2:62738538-62738560 ACAAGTGTCCTGCTCCACTTTGG + Intronic
932261436 2:70330901-70330923 ACATGTGTTTTGCTCCTCTCTGG - Intergenic
934320118 2:91964504-91964526 ACATGTGTAGGACTCCACTGGGG - Intergenic
935095546 2:99940973-99940995 ACCTGTCTGGTGCAGCACTCTGG + Intronic
935712887 2:105914650-105914672 ACAGGTGCTGTGCTCCTCTCTGG - Intergenic
936919112 2:117669699-117669721 CCATGTGTTGTCCTCCCCTCTGG + Intergenic
938171931 2:129086461-129086483 ACATGTAAGGTGCTTCAATCTGG - Intergenic
939637839 2:144604568-144604590 AACTGTGTGGTGCTCCAAACTGG + Intergenic
941683412 2:168423305-168423327 AGATCTGTGGTTCTCAACTCTGG + Intergenic
944732803 2:202534532-202534554 ACATGTGCTGTGTCCCACTCAGG - Intronic
1175737867 20:61399766-61399788 ACATGTGTGATGCTGGGCTCAGG + Intronic
1178508607 21:33183384-33183406 ACTTGTTTGTTGCTCCCCTCTGG + Intergenic
1178890534 21:36517503-36517525 ACATCAGTGGTTCTCCAGTCTGG + Intronic
1180308370 22:11148558-11148580 ACATGTGTAGGACTCCACTGGGG - Intergenic
1180546847 22:16510371-16510393 ACATGTGTAGGACTCCACTGGGG - Intergenic
1182212334 22:28686986-28687008 ACATGTGTAGGACTCCACTGGGG + Intergenic
1182429494 22:30291531-30291553 ACATTCGTGGTGCTCCACTCCGG + Intronic
1182486745 22:30643645-30643667 ACATGTGAGGTGCTGAACACAGG - Intronic
1185035072 22:48470487-48470509 ACATTTGTGTTACTCAACTCTGG - Intergenic
1185221159 22:49629851-49629873 ACATGTGTGAGCCTCCACCCTGG + Intronic
955862245 3:63343977-63343999 ACATCTGTGAGGCTTCACTCGGG - Intronic
965320985 3:167250925-167250947 ACCTGTGTGTTTTTCCACTCGGG - Intronic
967705529 3:192645600-192645622 ACATATCTGATGCTCCATTCTGG - Intronic
967798571 3:193627893-193627915 CCATGTTTGGTGCTCTACTCAGG - Intronic
969430045 4:7148684-7148706 AGATGTGAGGTGCACCAATCTGG - Intergenic
969816819 4:9693220-9693242 ACATCTGTGGTTCTTCTCTCAGG - Intergenic
970326199 4:14927652-14927674 ACCTTTGTGTTTCTCCACTCGGG + Intergenic
976398027 4:84578618-84578640 ACTTGTGTGGTGCTTCACGATGG + Intergenic
977454073 4:97235552-97235574 ACTTGCTTGGTGCTCCACTGTGG - Intronic
979239758 4:118437749-118437771 ACATAGGTGGTTCTCCACCCAGG - Intergenic
986192000 5:5505949-5505971 ACATGTGCTGTGCTACACACAGG + Intergenic
986251218 5:6060223-6060245 ACAGGCGTGGAGCTCCACACCGG + Intergenic
986273800 5:6256344-6256366 ACATGTGTTCTGCTCCTTTCTGG - Intergenic
987023125 5:13895495-13895517 ACATGCGTGCTGCTCCTCTGGGG + Intronic
991438614 5:66622314-66622336 ACACTTGTTCTGCTCCACTCTGG - Intronic
996857004 5:128019594-128019616 ACATGTCTGGTTCTTCCCTCTGG + Intergenic
1002740007 5:181428331-181428353 ACATAGGTGGTTCTCCACCCAGG - Intergenic
1002853861 6:1020689-1020711 ACATGCCTAGGGCTCCACTCGGG - Intergenic
1006388295 6:33744568-33744590 ACGTGTGTGCTGCTGCCCTCTGG - Intronic
1007605654 6:43116128-43116150 ACAAGGGGGTTGCTCCACTCAGG - Intronic
1007890881 6:45290369-45290391 ACATTTGTAGTACTCCAGTCAGG + Intronic
1014172058 6:118289685-118289707 AAATTTGTGGTTCTCAACTCTGG + Intronic
1017683050 6:156883374-156883396 ACAGTTGGGGTCCTCCACTCTGG + Intronic
1019097170 6:169591727-169591749 ACAGGTGTGGTGCTGCCCGCTGG + Intronic
1019245119 6:170703931-170703953 ACATAGGTGGTTCTCCACCCAGG - Intergenic
1024597648 7:50953639-50953661 ACCTGTGGGGGGCTCCACTGTGG + Intergenic
1027866396 7:83652942-83652964 ACATTTGAGGTGCTCCAGACTGG - Intergenic
1028884339 7:95914111-95914133 ACAGGTCTGGTGCCCCATTCAGG - Intronic
1029046853 7:97639161-97639183 ACATGTGTGGTGCTTGATTCTGG - Intergenic
1031662201 7:124439049-124439071 ACATGTGTCATGGTCCACTTTGG + Intergenic
1035544046 8:465722-465744 ACATGTGTAGTTTTCCACTGTGG + Intronic
1037599715 8:20383943-20383965 ACATGCGTGGTCATTCACTCTGG - Intergenic
1039433036 8:37540510-37540532 GCCTGTGTGGTGCTCTCCTCTGG + Intergenic
1041299618 8:56397312-56397334 ACAGGTGTAGGGCTCCACTGAGG + Intergenic
1044149806 8:88761575-88761597 ACATGTGTAGTGCAGGACTCTGG + Intergenic
1050590886 9:7159483-7159505 CCATGTGTGGTGCTTCCCTCAGG + Intergenic
1052466218 9:28833113-28833135 ACAGATGTGATGCTTCACTCTGG + Intergenic
1057394343 9:94666525-94666547 AAATGTGTGGTGCTCAATTTAGG + Intergenic
1057992890 9:99790615-99790637 CCATGTGTGGTGATCAAATCAGG + Intergenic
1061532662 9:131227280-131227302 ACCTGTGTGGTGCTGCCCTCTGG + Intronic
1203605314 Un_KI270748v1:53139-53161 ACATAGGTGGTTCTCCACCCAGG - Intergenic
1186505403 X:10087588-10087610 ACAGGTCTGGTGTTCCACACAGG + Intronic
1187229426 X:17406543-17406565 AGATGTGTGGTGCTGCAACCTGG - Intronic
1188102906 X:26112673-26112695 TCATGTGTGTGACTCCACTCTGG - Intergenic
1188457440 X:30382715-30382737 ACATGTGTAGTGGTCAAGTCAGG + Intergenic
1191225194 X:58035138-58035160 ACAGCTGTGGTGCTGCACTGTGG + Intergenic
1193203771 X:78723521-78723543 ACATTTCTGGTTCTCCACTGAGG - Intergenic
1194188100 X:90799171-90799193 AGATGTGTGGTGTTTTACTCAGG - Intergenic
1194272565 X:91835547-91835569 GCATGCGTGGTGTTCCACTCTGG + Exonic
1199339363 X:146658947-146658969 ACATGTGAGGAACTCCCCTCTGG - Intergenic
1200534692 Y:4381116-4381138 AGATGTGTGGTGTTTTACTCAGG - Intergenic
1200589808 Y:5056962-5056984 GTATGCGTGGTGTTCCACTCTGG + Exonic
1201187639 Y:11419612-11419634 ACATGTGTAGGACTCCACTGGGG - Intergenic
1201563315 Y:15341356-15341378 ACATGTTTAGTGCTTCATTCAGG + Intergenic
1202387499 Y:24339579-24339601 ACATAGGTGGTTCTCCACCCAGG - Intergenic
1202483287 Y:25330549-25330571 ACATAGGTGGTTCTCCACCCAGG + Intergenic