ID: 905293345

View in Genome Browser
Species Human (GRCh38)
Location 1:36938426-36938448
Sequence AACCTTGACCTGCTACTGCC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 120
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 110}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905293339_905293345 26 Left 905293339 1:36938377-36938399 CCAAAGTTGAATGACCACATAGC 0: 1
1: 0
2: 0
3: 10
4: 96
Right 905293345 1:36938426-36938448 AACCTTGACCTGCTACTGCCGGG 0: 1
1: 0
2: 1
3: 8
4: 110
905293343_905293345 12 Left 905293343 1:36938391-36938413 CCACATAGCAGGGGTTTGCAATG 0: 1
1: 0
2: 0
3: 11
4: 121
Right 905293345 1:36938426-36938448 AACCTTGACCTGCTACTGCCGGG 0: 1
1: 0
2: 1
3: 8
4: 110
905293338_905293345 27 Left 905293338 1:36938376-36938398 CCCAAAGTTGAATGACCACATAG 0: 1
1: 0
2: 0
3: 19
4: 168
Right 905293345 1:36938426-36938448 AACCTTGACCTGCTACTGCCGGG 0: 1
1: 0
2: 1
3: 8
4: 110

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905293345 Original CRISPR AACCTTGACCTGCTACTGCC GGG Intronic
901440266 1:9273424-9273446 GACCTTGCCCTGCTTCTGCGTGG - Intergenic
903920931 1:26800145-26800167 AACCTTGTCCAGCTCATGCCAGG - Intergenic
905293345 1:36938426-36938448 AACCTTGACCTGCTACTGCCGGG + Intronic
911836814 1:102630198-102630220 CACCTTGAACTGCTGCTGGCTGG - Intergenic
912725631 1:112056949-112056971 TACCTTGACCTGCAACTTCCTGG + Intergenic
913339026 1:117738745-117738767 CACCTTGACCTTCGACTTCCAGG - Intergenic
914957840 1:152180616-152180638 CACCTTGTCCTGCTCCTGCAGGG + Intergenic
915599019 1:156910691-156910713 GAACGGGACCTGCTACTGCCTGG + Exonic
915903456 1:159862333-159862355 ACCCTTGCCCTGCTGCAGCCGGG - Intronic
917847115 1:179029004-179029026 AACCTGCACAGGCTACTGCCAGG - Intronic
917936975 1:179877905-179877927 ATCCTTCACCCTCTACTGCCAGG + Intergenic
920377289 1:205516000-205516022 AACCTTGCCCTGCCCCAGCCTGG - Intronic
923412026 1:233720057-233720079 AACCATAACTTGCTATTGCCTGG - Intergenic
924668630 1:246100348-246100370 AACTGTGACCTGCCGCTGCCTGG + Intronic
1065734422 10:28738641-28738663 AACCTTGACCTGCTCTTCCACGG - Intergenic
1067487089 10:46660841-46660863 CACCTCTACCTGCTACTGCCTGG + Intergenic
1067607714 10:47681135-47681157 CACCTCCACCTGCTACTGCCTGG - Intergenic
1071009711 10:80923755-80923777 TCCCTTGTCCTGCTATTGCCTGG - Intergenic
1071623272 10:87142532-87142554 CACCTCCACCTGCTACTGCCTGG - Intronic
1076732877 10:132447069-132447091 ACCCCTGACCTGCCAGTGCCAGG - Intronic
1077764039 11:5137715-5137737 ATCCTAGACCTGCTATTGCTTGG + Intergenic
1079566298 11:21887461-21887483 AACCTTGAACTGCTTCTACCAGG + Intergenic
1080531720 11:33182721-33182743 GACCTTGACCTGCTGCTGGAAGG - Intergenic
1085449842 11:76625186-76625208 ACCCTTGACCAGCTCCTGCCTGG + Intergenic
1088616226 11:111631740-111631762 AACCGTGCCCTGCTAATTCCAGG + Intronic
1089814187 11:121157978-121158000 CACCAAGACCTCCTACTGCCTGG + Exonic
1090404764 11:126469974-126469996 AACCCAGGCCTGCGACTGCCTGG + Intronic
1091928856 12:4378615-4378637 TAGCTTGACTTGCTACTGACTGG + Intronic
1094503070 12:31037431-31037453 CACCTTCTCCTGCTCCTGCCAGG + Intergenic
1096430525 12:51539248-51539270 AACCTCCACCTTCTCCTGCCTGG + Intergenic
1097277901 12:57825660-57825682 ATCCTTAACCTGGGACTGCCTGG + Intronic
1101818116 12:108161592-108161614 CACCTTGACCTCTGACTGCCAGG + Intronic
1102282169 12:111627014-111627036 ATCCCAGCCCTGCTACTGCCTGG - Intergenic
1107162096 13:37242107-37242129 AACCTTGAGGGGCTACAGCCAGG + Intergenic
1108344045 13:49526864-49526886 AAGCTTTACCAGCTCCTGCCTGG - Intronic
1109624846 13:64961761-64961783 AACCCTGACCTGATACTTACTGG + Intergenic
1113909349 13:113834845-113834867 ACCCTCGGCCTGCTCCTGCCCGG + Intronic
1115935528 14:38548071-38548093 AACCTGGAGTTGCTACTGGCAGG + Intergenic
1118010491 14:61605797-61605819 TCCCTTGATCTGCAACTGCCTGG - Intronic
1123866694 15:24526645-24526667 ATCCTCCACCTGCTCCTGCCTGG - Intergenic
1127583880 15:60363374-60363396 AGGCTTGACCTGCAACTCCCAGG + Intronic
1129707717 15:77804258-77804280 AGCCTTGCCCTGTTCCTGCCTGG - Intronic
1133273899 16:4625245-4625267 TACCTGGCGCTGCTACTGCCCGG + Intronic
1133523897 16:6585017-6585039 AGCCTTGACCAGGTTCTGCCTGG - Intronic
1134113961 16:11534257-11534279 AACCTTGTCCTGCTCCTGGAAGG + Intergenic
1142412198 16:89922620-89922642 CACCTGGACGTGCCACTGCCCGG - Intronic
1143730533 17:8880387-8880409 ATCCTTCTCCTTCTACTGCCAGG + Exonic
1147122065 17:38341455-38341477 AGCCCTGACCTGGCACTGCCTGG + Intronic
1148330570 17:46811603-46811625 CACCCTGTCCTGCTGCTGCCTGG - Intronic
1148361150 17:47013511-47013533 AACCCTTTCCTGCTACAGCCTGG + Intronic
1150478911 17:65494665-65494687 AACCTGGACCTGCTTGTCCCAGG + Intergenic
1156539646 18:37897102-37897124 AGCCTTGGCCTGATTCTGCCAGG - Intergenic
1158079180 18:53568215-53568237 AACCTTGGCCTGCGATGGCCTGG + Intergenic
1161272643 19:3398543-3398565 AACCATCACCTTCTTCTGCCTGG + Intronic
1163644845 19:18483298-18483320 AACCCTGCACTGCAACTGCCAGG - Intronic
1164558735 19:29273751-29273773 AACCTTGACCTGATTCAGCAAGG + Intergenic
1167470349 19:49672294-49672316 ACACTTGACCAGCTCCTGCCAGG - Intronic
924986063 2:271054-271076 GACCTTGGGCTGCTAATGCCTGG + Intronic
926738150 2:16090053-16090075 AACCTTGACCAGGTACACCCTGG + Intergenic
926738169 2:16090149-16090171 AACCTTGACCAGGTACACCCTGG + Intergenic
926738188 2:16090245-16090267 AACCTTGACCAGGTACACCCTGG + Intergenic
926738207 2:16090341-16090363 AACCTTGACCAGGTACACCCTGG + Intergenic
932451552 2:71813792-71813814 AACCTTGACCCTCTTCTGCTTGG + Intergenic
934766275 2:96881869-96881891 AACCTAAACCTGCCACTGCCTGG + Intronic
937243209 2:120475777-120475799 AACCTGGAGCTGCTGCTCCCCGG - Intergenic
938398226 2:130965953-130965975 AACCCTGCCCTGCCATTGCCGGG - Intronic
942515268 2:176746113-176746135 ATCCTTAACCTGTAACTGCCTGG + Intergenic
945810369 2:214542469-214542491 AAGCTTCTCCTGCTGCTGCCTGG + Intronic
948223406 2:236290849-236290871 ACCCTTCCCCTGCTTCTGCCGGG - Intergenic
948945160 2:241215629-241215651 ATCCGTGCCCTGCTCCTGCCAGG - Intronic
1170745530 20:19095419-19095441 AGCCTTCACCTGCAAGTGCCAGG + Intergenic
1172360759 20:34311425-34311447 GACCGGGACCTGCTTCTGCCTGG - Intronic
1177185758 21:17794207-17794229 ATCCTTGATCTGCTACTGATTGG + Intronic
1177906220 21:26974118-26974140 AAGCTTGAGCTCCTACTGCATGG - Intergenic
1178594821 21:33943696-33943718 AATCAAGTCCTGCTACTGCCAGG + Intergenic
1181527826 22:23500273-23500295 CAGCTTGTCCTGCTAGTGCCTGG - Intergenic
1181532929 22:23527269-23527291 AACAGTGGCCTGCTCCTGCCTGG - Intergenic
1182575190 22:31268154-31268176 AAACCTGACCTTCTGCTGCCAGG - Exonic
950265499 3:11570062-11570084 AACCTTTACCTGCTGCCCCCTGG + Intronic
950340155 3:12236441-12236463 AACGTTGACATTCTAATGCCTGG - Intergenic
954406040 3:50345551-50345573 GACCTGGAACTGCTGCTGCCCGG - Exonic
956213903 3:66828462-66828484 CACCTTGTCCTGCTTGTGCCAGG + Intergenic
956449734 3:69362294-69362316 AGCCTTCATCTGCTACTTCCTGG - Intronic
959429989 3:106241545-106241567 AGCCTTGACTTGGCACTGCCAGG - Intergenic
960131948 3:114066418-114066440 AATCTTGACTTGCCAATGCCTGG - Intronic
961884742 3:130089169-130089191 CAGCTTGCCCTCCTACTGCCTGG - Intronic
964749098 3:160038423-160038445 ACCCCTGACCTGCTTCTGGCAGG + Intergenic
967222165 3:187256568-187256590 AACCTTCACCTTCTTCTCCCAGG - Intronic
967356724 3:188579917-188579939 AGCCTTGACCTCCTACCTCCTGG - Intronic
968076963 3:195821296-195821318 AAGGTTGACCTGCTATTGACTGG + Intergenic
975451949 4:74538780-74538802 AACCTTGACCTTGTACCTCCAGG + Intergenic
977851081 4:101830574-101830596 AACCTTGAACTGCTACTGACTGG - Intronic
983558186 4:169076922-169076944 ATCCTTGACCTACTCCTGCAAGG - Intergenic
985572052 5:652142-652164 TACCTTGACCTGCCACAGACAGG - Intronic
991046760 5:62231128-62231150 AACCTTGACAAGCTGTTGCCAGG - Intergenic
992073535 5:73170605-73170627 AAACTGGAACTGTTACTGCCAGG + Intergenic
993348249 5:86812891-86812913 AACCTGGACTTGCTGCTACCAGG + Intergenic
994911658 5:105917234-105917256 GACCTTCACCTGCAACTCCCTGG + Intergenic
994930803 5:106181776-106181798 ATTCATGACCTGCTTCTGCCTGG - Intergenic
1004355945 6:14930138-14930160 AAAGTTGACCTGGTACTGGCTGG - Intergenic
1005898569 6:30198282-30198304 AACCCAGGTCTGCTACTGCCAGG + Intronic
1009544437 6:65005791-65005813 GATCTTAACCGGCTACTGCCGGG - Intronic
1013557981 6:111276637-111276659 AAGCTGTACCTGCTACTGCAAGG - Intergenic
1021764997 7:23939837-23939859 AACCTTGACCTTGACCTGCCAGG - Intergenic
1023038799 7:36154590-36154612 AAACTTGACCTGCTCCAGCTTGG - Exonic
1024696008 7:51857366-51857388 AACCCTGACCTGATCCTGACAGG + Intergenic
1034088095 7:148338619-148338641 AGGCTTCAGCTGCTACTGCCTGG + Intronic
1034569868 7:151946750-151946772 AGACTTGAGCTGCTACAGCCTGG - Intergenic
1036613853 8:10373523-10373545 TACCTTGCCCAGCTACTGACTGG + Intronic
1040416484 8:47200494-47200516 AACCTTGACCCTCTCCTTCCAGG + Intergenic
1046314710 8:112483979-112484001 CACCTTGACCTTCAACAGCCAGG - Intronic
1058226685 9:102372430-102372452 AATCTTGACCTGATACTTTCTGG - Intergenic
1058764539 9:108168614-108168636 AACCAGGACCTGCTGCTGCCAGG + Intergenic
1059197092 9:112380270-112380292 ATCCTTGACCTCCCACAGCCGGG - Intronic
1059490914 9:114666684-114666706 AAACTTAAACCGCTACTGCCAGG - Intergenic
1061247536 9:129408565-129408587 AACAGTGGCCTGCTCCTGCCTGG + Intergenic
1061256416 9:129456196-129456218 CAGCTTGTCCTGCTAGTGCCTGG + Intergenic
1061749683 9:132769212-132769234 CACCCTGCCCTGCCACTGCCTGG + Intronic
1062507917 9:136887227-136887249 AAACATCCCCTGCTACTGCCAGG - Intronic
1190962259 X:55264463-55264485 CACCTCGCCCTGCCACTGCCCGG + Intronic