ID: 905293493

View in Genome Browser
Species Human (GRCh38)
Location 1:36939461-36939483
Sequence AACTGCATGCAGAAGGCAGA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 459
Summary {0: 1, 1: 0, 2: 4, 3: 33, 4: 421}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905293490_905293493 1 Left 905293490 1:36939437-36939459 CCCGCTTAGAAGAGGTGGGACTA 0: 1
1: 0
2: 1
3: 3
4: 99
Right 905293493 1:36939461-36939483 AACTGCATGCAGAAGGCAGACGG 0: 1
1: 0
2: 4
3: 33
4: 421
905293486_905293493 6 Left 905293486 1:36939432-36939454 CCATCCCCGCTTAGAAGAGGTGG 0: 1
1: 0
2: 0
3: 6
4: 93
Right 905293493 1:36939461-36939483 AACTGCATGCAGAAGGCAGACGG 0: 1
1: 0
2: 4
3: 33
4: 421
905293489_905293493 2 Left 905293489 1:36939436-36939458 CCCCGCTTAGAAGAGGTGGGACT 0: 1
1: 0
2: 1
3: 7
4: 63
Right 905293493 1:36939461-36939483 AACTGCATGCAGAAGGCAGACGG 0: 1
1: 0
2: 4
3: 33
4: 421
905293491_905293493 0 Left 905293491 1:36939438-36939460 CCGCTTAGAAGAGGTGGGACTAG 0: 1
1: 0
2: 2
3: 10
4: 131
Right 905293493 1:36939461-36939483 AACTGCATGCAGAAGGCAGACGG 0: 1
1: 0
2: 4
3: 33
4: 421
905293484_905293493 10 Left 905293484 1:36939428-36939450 CCAGCCATCCCCGCTTAGAAGAG 0: 1
1: 0
2: 0
3: 2
4: 71
Right 905293493 1:36939461-36939483 AACTGCATGCAGAAGGCAGACGG 0: 1
1: 0
2: 4
3: 33
4: 421

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905293493 Original CRISPR AACTGCATGCAGAAGGCAGA CGG Intronic
900039192 1:442587-442609 AACTTCATGCAGCATGCACAAGG + Intergenic
900060625 1:677563-677585 AACTTCATGCAGCATGCACAAGG + Intergenic
900670774 1:3853009-3853031 TTCTGCAGGCAGAAGTCAGATGG - Intronic
900986039 1:6073234-6073256 TACTGCATGCAGAGGGGAGGTGG - Intronic
901648037 1:10727139-10727161 AACAGCCTGGAGAAGGAAGAGGG + Intronic
903291409 1:22316495-22316517 AAATGCATACAGAAGGCTGGTGG - Intergenic
904651719 1:32011007-32011029 AACTGCATGAAGAGGGGGGAAGG - Intergenic
905293493 1:36939461-36939483 AACTGCATGCAGAAGGCAGACGG + Intronic
905409605 1:37759365-37759387 AATTGCATGCAGAAGGATGGAGG - Intronic
906695875 1:47823202-47823224 AGCTGCATGGGGGAGGCAGACGG + Intronic
907276192 1:53317815-53317837 GAGTGCAGGAAGAAGGCAGAAGG + Intronic
907290907 1:53412357-53412379 CCCTGCATGAAGGAGGCAGAAGG + Intergenic
907597620 1:55734085-55734107 AGCTGCTTGCTGAAGGCAAAGGG + Intergenic
908023502 1:59923009-59923031 AACTCCCTGCAGGAGTCAGAGGG + Intronic
908824638 1:68121590-68121612 GACAGCCTGCAGAAGTCAGATGG + Intronic
909172342 1:72313467-72313489 AAGTGCTTGCTGAAGGCAAAGGG - Intergenic
910854316 1:91679650-91679672 AACTGTATCCTGAAGGCAAATGG + Intergenic
911483090 1:98469777-98469799 AATTACATCCAGAAAGCAGATGG - Intergenic
911586111 1:99692784-99692806 AACAGAAGGCAGAAGGCAGAAGG - Intronic
911903722 1:103538250-103538272 AACTGAAACAAGAAGGCAGAGGG - Intronic
912785067 1:112594653-112594675 ATCTGAATTCAGAAGACAGATGG + Intronic
912860416 1:113209208-113209230 GATGGCATGCAGAAGGAAGAGGG + Intergenic
913218998 1:116644454-116644476 ACCTGCATGCAGAAGCCACTGGG - Intronic
913228375 1:116720498-116720520 AACTGTATGCTGAAGGCAATGGG - Intergenic
914253670 1:145943091-145943113 AACTGAATGCAGAACGAGGAAGG + Intronic
914682374 1:149947841-149947863 AAGTTGATGCAGGAGGCAGAAGG + Intronic
915341477 1:155179003-155179025 AAGCGCCTGAAGAAGGCAGAAGG - Intronic
915652662 1:157329193-157329215 AACTACATTCCTAAGGCAGAGGG + Intergenic
916652894 1:166847245-166847267 AACTGCATTTAGCAGGGAGAAGG - Intronic
917216944 1:172688938-172688960 AAGTGCTTGCTGAAGGCAAAGGG - Intergenic
917676307 1:177322294-177322316 AGCTGCTTGAGGAAGGCAGAAGG - Intergenic
918303394 1:183224301-183224323 TACAGCATGCATAAGGAAGATGG + Intronic
919180281 1:194071451-194071473 AAATGCATGCAGATGCCAAATGG - Intergenic
919759661 1:201089462-201089484 ATCTGGAGGCAGAAGGCAAAGGG + Exonic
919830588 1:201538258-201538280 GTCTGCAGGAAGAAGGCAGAAGG - Intergenic
921422066 1:214959677-214959699 AAGTGGAGGCAGAAGGGAGAGGG + Intergenic
922662797 1:227444737-227444759 AAGTGCTTGCTGAAGGCAAATGG + Intergenic
923694540 1:236234596-236234618 AACTGCCTGGAGAAGGAAGTTGG - Intronic
923736675 1:236615935-236615957 AACTGCGTGCTCAAGCCAGAAGG + Intergenic
924235853 1:241999095-241999117 AACTGCCTGCAGGAGCCTGAAGG + Intergenic
924345484 1:243069383-243069405 AACTGGAAGAGGAAGGCAGAAGG + Intergenic
1062762578 10:36661-36683 AACTACGTGAAGAATGCAGAAGG + Intergenic
1064701270 10:18023984-18024006 AACTGCAGCCTGAGGGCAGAAGG + Intronic
1064741547 10:18439804-18439826 ACTGGCATGCAGTAGGCAGAAGG - Intronic
1064920680 10:20514234-20514256 TACTGCATGGAAAAAGCAGAAGG + Intergenic
1065902949 10:30224435-30224457 AACTGCCTGGAGAAGTCAAAAGG - Intergenic
1067355189 10:45517558-45517580 GGCTGCTTACAGAAGGCAGAGGG - Intronic
1067690294 10:48497463-48497485 AAGGAGATGCAGAAGGCAGAGGG + Intronic
1067700027 10:48564743-48564765 AAATGCTTGCAGAAGAGAGAGGG - Intronic
1067754084 10:48991741-48991763 AGGTGCTTGCTGAAGGCAGAGGG - Intergenic
1068535885 10:58241159-58241181 AACGACTTGCTGAAGGCAGAAGG + Intronic
1069558380 10:69412789-69412811 GTCTCCATGCAGAAGGCAGAGGG + Intronic
1071029273 10:81155362-81155384 AATAGCAAGCAGAAGGCACACGG - Intergenic
1071116077 10:82221977-82221999 AACTGCAAGCAGAAGAAAGCAGG - Intronic
1072288863 10:93943718-93943740 AACAGCATGCAGAAGACATTTGG - Intronic
1072693924 10:97589470-97589492 GATTCCAAGCAGAAGGCAGAAGG + Intronic
1072866238 10:99065310-99065332 AACTGGGTGCAGAAGGAAAATGG - Intronic
1072925485 10:99613168-99613190 AACTGCATGAAGAAACCAGAAGG - Intronic
1073599860 10:104836072-104836094 AGCTCCATCCAGGAGGCAGAGGG + Intronic
1073806430 10:107103718-107103740 AAATGCCTGCACAATGCAGATGG - Intronic
1074396257 10:113100366-113100388 ATCTGCCTTTAGAAGGCAGAAGG + Intronic
1075410170 10:122221883-122221905 AGCCCCATGCAGAAGCCAGAAGG - Intronic
1076046086 10:127295236-127295258 TACTCCTGGCAGAAGGCAGAAGG + Intronic
1076358534 10:129870188-129870210 AAATACAGGCAGAAGGAAGATGG - Intronic
1076359811 10:129879667-129879689 TACTGTATGCTGATGGCAGATGG - Intronic
1076926992 10:133496238-133496260 AGGTGCTTGCAGAAGGCAAAGGG - Intergenic
1076965408 11:78496-78518 AACTTCATGCAGCATGCACAAGG + Intergenic
1077249464 11:1554609-1554631 AACGGCCTGCAGAAGGGACAAGG + Exonic
1080360779 11:31510353-31510375 AGCTGCCTGGAGAAAGCAGAAGG - Intronic
1081033469 11:38114163-38114185 AACTGCTCGAGGAAGGCAGAAGG - Intergenic
1082906096 11:58310013-58310035 AGCTGCTTGAGGAAGGCAGAAGG + Intergenic
1084594127 11:70107074-70107096 AACTGCATGTGGAAGGGAGGAGG + Intronic
1085370912 11:76004374-76004396 AACCGCATGTAGAAGACAGAAGG - Intronic
1086087784 11:82972364-82972386 AAATGCACGCCCAAGGCAGAGGG + Intergenic
1087625594 11:100592518-100592540 AAGAACATGCAGAAGGCAGCCGG + Intergenic
1087716343 11:101613099-101613121 AACAGCATGGAGGAGGCAAAAGG - Intronic
1088388531 11:109287913-109287935 AAGTGCTTGCTGAAGGCAAAGGG + Intergenic
1089002967 11:115067622-115067644 AAAACCAGGCAGAAGGCAGAAGG - Intergenic
1089298165 11:117481873-117481895 ATCTGCATCCAGGAGGCAAATGG - Intronic
1089691610 11:120190341-120190363 TACGGCATGCAGAATGGAGAGGG + Intergenic
1090539301 11:127682896-127682918 AACTGAATGCAGTAAGCAGTGGG - Intergenic
1092323905 12:7509077-7509099 AACTACGTGAAGAATGCAGAAGG - Intergenic
1092489638 12:8933315-8933337 GACTGCATATAGAAGGCAGCAGG - Exonic
1092601454 12:10070797-10070819 AACGGCATGGACAAGGCAGATGG + Exonic
1093114220 12:15189822-15189844 AAATTCATGGAAAAGGCAGAAGG + Intronic
1093753075 12:22822483-22822505 AGATGCTTGCAGAAGGCAAAGGG + Intergenic
1094070187 12:26404197-26404219 AACTGTAGGCAGAAGGGGGAAGG + Intronic
1095809936 12:46362324-46362346 AACTTGATATAGAAGGCAGAAGG + Exonic
1096946297 12:55412857-55412879 GACTGCATATAGAAGGCAGCAGG + Intergenic
1098063541 12:66587794-66587816 CATTCCGTGCAGAAGGCAGAGGG + Intronic
1098114818 12:67163935-67163957 ATCTGGTTGCAGAAAGCAGATGG - Intergenic
1098142237 12:67462079-67462101 AACAGCAGGTAGAAAGCAGATGG - Intergenic
1098700461 12:73617867-73617889 AACTGCAGCCAAAAGGAAGAGGG + Intergenic
1098702286 12:73644839-73644861 AGGTGCCTGCAGAAGACAGAAGG - Intergenic
1099941344 12:89192886-89192908 AACTTTATGCAGAAGACAGGAGG + Intergenic
1101401984 12:104396414-104396436 ATTTGGGTGCAGAAGGCAGATGG - Intergenic
1101428758 12:104609056-104609078 AATAGCATTCAAAAGGCAGAGGG - Intronic
1101694850 12:107115521-107115543 GACAGAATGAAGAAGGCAGAGGG + Intergenic
1103298088 12:119905397-119905419 AATTGCTTGAAGGAGGCAGAGGG + Intergenic
1103600303 12:122050543-122050565 TTCTGCAGGTAGAAGGCAGAGGG + Intronic
1104073737 12:125371171-125371193 GAAAGCATGCAGAAGGTAGAAGG - Intronic
1104737232 12:131143140-131143162 AGCTGCAAGCATGAGGCAGAGGG + Intergenic
1104960225 12:132485061-132485083 AGTGGAATGCAGAAGGCAGAGGG - Intergenic
1105278516 13:18949895-18949917 AACTGCCTGCAGCGGGCTGAGGG + Intergenic
1105356635 13:19665006-19665028 CACAGCAGGCAGAAGGCAGGCGG + Intronic
1105553088 13:21416757-21416779 AACAGCATACAGAAAGCACAAGG + Intronic
1105896285 13:24719327-24719349 ACCTGCACTCAGAAGGCAGGAGG + Intergenic
1106138066 13:26989537-26989559 AACTGTTTCCAGAAGACAGAGGG + Intergenic
1106681268 13:32010949-32010971 AGCTGCATGCACAGGGCACATGG - Intergenic
1108167832 13:47711242-47711264 AACTACTTCCAGAAGCCAGAGGG + Intergenic
1108314678 13:49225456-49225478 TTCTGCCTGCAGAAGGGAGAGGG - Intergenic
1109283299 13:60382069-60382091 AACAGCATGTGGGAGGCAGAAGG - Intergenic
1109525508 13:63569110-63569132 AACTGCTTTCAGAAAGCACATGG - Intergenic
1112122193 13:96425107-96425129 ACATGCATATAGAAGGCAGAAGG - Intronic
1113043138 13:106125744-106125766 AATTGCATGCAGAAGCCATGTGG - Intergenic
1113681919 13:112250485-112250507 CCCTCCAGGCAGAAGGCAGAAGG + Intergenic
1115020412 14:28673634-28673656 AACTGCTCGCAGAAAGAAGAAGG - Intergenic
1115863281 14:37713258-37713280 AAATGCAATTAGAAGGCAGAAGG - Intronic
1116013510 14:39379371-39379393 AACTGCATTCATGAGGCACAGGG - Intronic
1116068356 14:40011103-40011125 AAGTGCTTGCTGAAGGCAAAGGG + Intergenic
1117487999 14:56217817-56217839 CACTGTATGGAGCAGGCAGAAGG - Intronic
1118122165 14:62858238-62858260 AAGTGCTTGCTGAAGGCAAAAGG - Intronic
1120573307 14:86148740-86148762 CATCTCATGCAGAAGGCAGAAGG + Intergenic
1120740728 14:88106148-88106170 AGCTGCAGGCAGGTGGCAGAAGG + Intergenic
1121551637 14:94807215-94807237 AAATGTTTGCAGAAGGTAGAAGG - Intergenic
1121661243 14:95636711-95636733 AATTGCCTGCTGAAGGTAGAGGG + Intergenic
1122091794 14:99345803-99345825 AACCCCATGCAGAAGGAGGAGGG + Intergenic
1202935226 14_KI270725v1_random:81793-81815 AGCTGCTTGCTGAAGGCAAAGGG - Intergenic
1123847740 15:24320503-24320525 AACTGCATACGGAAGGCACAGGG + Intergenic
1123866781 15:24527880-24527902 AACTGCATAAAGAAGGCACAGGG + Intergenic
1125205378 15:37148623-37148645 AAATGGAGGCAGGAGGCAGAAGG - Intergenic
1125724249 15:41860358-41860380 AACTGAATGAAGAAGGAAGTGGG + Intronic
1126769131 15:52037626-52037648 AACAACATGAAGAAGGCAGCTGG - Intronic
1127031888 15:54873027-54873049 AACTACATGAAGACTGCAGAAGG + Intergenic
1127721345 15:61703045-61703067 AACTGCACGCAGCAGCCAGTAGG + Intergenic
1128851859 15:70967109-70967131 AAAGGCATGCAAAATGCAGAAGG + Intronic
1129976518 15:79826696-79826718 GCTTTCATGCAGAAGGCAGAGGG - Intergenic
1131398845 15:92108685-92108707 AGCTGGAGGGAGAAGGCAGATGG - Intronic
1131531259 15:93194395-93194417 AACAGCATAAAGAAGGAAGAAGG - Intergenic
1132442718 15:101885025-101885047 AACTTCATGCAGCATGCACAAGG - Intergenic
1133162406 16:3920714-3920736 AACTGCCTGCAGAAGGAAGAGGG - Intergenic
1133628559 16:7595528-7595550 CCCTGCATGCAGGAGGGAGAAGG - Exonic
1134711204 16:16327591-16327613 AGGTGCAGGCAGAAGGAAGAGGG - Intergenic
1134948370 16:18340992-18341014 AGGTGCAGGCAGAAGGAAGAGGG + Intergenic
1134955625 16:18381102-18381124 AGGTGCAGGCAGAAGGAAGAGGG + Intergenic
1135145938 16:19962730-19962752 AGCTGGAAGGAGAAGGCAGAAGG + Intergenic
1135945043 16:26858091-26858113 AACTGCTTGCACAAAGCACATGG + Intergenic
1137512700 16:49115330-49115352 AAATGCAAGCAGAAGCCAGGAGG + Intergenic
1138658437 16:58503817-58503839 CACTACATGCAGAAGGCCGTAGG - Exonic
1138868649 16:60852756-60852778 AGCTGCTTGCTGAAGGCAAATGG + Intergenic
1138929091 16:61630615-61630637 ATCTGCAGGCAGAGGACAGAGGG + Intergenic
1139323297 16:66132787-66132809 TACTGCATCCAGATGGCAGGAGG + Intergenic
1139830916 16:69797518-69797540 AAATGTATGCACATGGCAGAGGG + Intronic
1140868064 16:79081468-79081490 AAATGACTGCAGAAAGCAGATGG - Intronic
1142023637 16:87800525-87800547 AAGTCCTGGCAGAAGGCAGAAGG + Intergenic
1142872026 17:2827374-2827396 AACAGAATGAAGAACGCAGATGG + Intronic
1143473119 17:7188516-7188538 AAACACATGAAGAAGGCAGAAGG + Intergenic
1143522178 17:7451017-7451039 AACTGAATGAAGTAAGCAGAGGG + Intronic
1143797186 17:9346586-9346608 ACCTGCATGCATAAGCTAGAGGG - Intronic
1144210678 17:13012517-13012539 GACTGAAGGCAGAAGGCAGCAGG - Intronic
1144268993 17:13600408-13600430 CACTTCATGCAGAAGGCGAAGGG - Intronic
1144388621 17:14772859-14772881 AACTGAGAGCAGAAGGCAGAAGG + Intergenic
1146110495 17:30084769-30084791 AAATGCAAGCAGAAGCCAAAGGG - Intronic
1146956914 17:36941263-36941285 CACTTTGTGCAGAAGGCAGAGGG - Intronic
1147253887 17:39170186-39170208 AATTTCAGGCAGAAGGCACATGG + Intergenic
1148909994 17:50936828-50936850 AACTGCATGCAGGAGGAGGGAGG - Intergenic
1151192344 17:72407649-72407671 AACTGCATGCACTTGGCAGTGGG + Intergenic
1151568052 17:74911016-74911038 AGCTGCTTGAGGAAGGCAGAAGG - Intergenic
1152252073 17:79217546-79217568 AGCTGCAGGCAGAGGGGAGATGG + Intronic
1152955488 18:36992-37014 AACTACGTGAAGAATGCAGAAGG + Intergenic
1154207292 18:12348049-12348071 ACCTCCATGCAGAGGGCAGGTGG + Intronic
1156220868 18:35050825-35050847 AAATGCATGGTGAATGCAGATGG - Intronic
1156539847 18:37898691-37898713 ATCTGGATGCTGAAGGCAAATGG + Intergenic
1157663143 18:49463244-49463266 AACTGCCTGCAGAAGTATGATGG + Intergenic
1157895304 18:51460886-51460908 AAGTTCATGAAGGAGGCAGAAGG - Intergenic
1158341150 18:56468036-56468058 AACAGCATGTGGAAGGAAGAAGG + Intergenic
1158859020 18:61573949-61573971 AACTGCAGAGTGAAGGCAGAGGG + Intergenic
1159263797 18:66052197-66052219 CACTGCATTCAGTAGCCAGAAGG + Intergenic
1159994462 18:74950099-74950121 AGCTGCATACAGCAGGCAGGAGG + Intronic
1160219827 18:76966575-76966597 AACTGCATGCTGCAGGAAAAGGG - Intronic
1160557474 18:79735566-79735588 AACTGCACGGAGATGGGAGAAGG - Intronic
1160642212 19:148126-148148 AACTTCATGCAGCATGCACAAGG + Intergenic
1161618567 19:5286284-5286306 ACCTTCATGGAGGAGGCAGAGGG + Intronic
1161625801 19:5325862-5325884 AAATTCAGGCCGAAGGCAGAAGG + Intronic
1161955989 19:7495314-7495336 ATCTGTATGAAGAAGTCAGAAGG - Intronic
1162543109 19:11310223-11310245 AAGTGCAGGAAGAAGGAAGAAGG + Intronic
1163066600 19:14801241-14801263 AACTCCATGCAGATAGCAGGGGG - Intronic
1163127604 19:15252720-15252742 AACTGCATGCAGAATGCCGTGGG - Intronic
1163332242 19:16647256-16647278 AACAGCCTGGAGAAGTCAGAGGG + Exonic
1163442744 19:17329830-17329852 AACTGCAGGAAGGAGGCAGGCGG + Exonic
1164736997 19:30548941-30548963 AACTGCTTGTAGAAGTCTGATGG - Exonic
1164743740 19:30595649-30595671 AACTGCTTGGAGAAAGCAGGTGG - Intronic
925099290 2:1231724-1231746 ACCAGCAGGCAGCAGGCAGAGGG + Intronic
925346384 2:3174958-3174980 AGCTGCATGCTGGAGGCAGGTGG + Intergenic
926618351 2:15021949-15021971 AATTGTAGGCAGAAGGCAGAAGG + Intergenic
926760767 2:16277063-16277085 AAAACCATGCAGAAGCCAGAGGG + Intergenic
927640314 2:24841615-24841637 CACTGCAGGCAGAAGACAGCTGG + Exonic
928908183 2:36390632-36390654 AACTGCAAGCAGAAATGAGAAGG - Intronic
929093287 2:38240572-38240594 TTCTGCATGTAGTAGGCAGAGGG - Intergenic
930332760 2:50006977-50006999 AAATGCATGCACTAGGCAGATGG + Intronic
930800157 2:55435539-55435561 AACTGCTTGCAGAAAGAAGGTGG - Intergenic
930880509 2:56264885-56264907 ACCTGCAGGCAAAAGGCAGAAGG - Intronic
931590131 2:63873984-63874006 AACAGCAGGAAGAAGGAAGATGG + Intronic
932400488 2:71477527-71477549 ACCTGCTTACAGAAGGCTGATGG + Intronic
933856237 2:86417390-86417412 AGCTGCATGCTGAAGACAGAAGG - Intergenic
934502266 2:94870454-94870476 GACTGCATGCGCCAGGCAGACGG + Intergenic
934605323 2:95690781-95690803 GCCTGCCTGCAGGAGGCAGAGGG - Intergenic
935570401 2:104654335-104654357 TAGTGCATACAGTAGGCAGATGG - Intergenic
935738837 2:106128640-106128662 TCTTGCTTGCAGAAGGCAGACGG + Intronic
936048310 2:109203497-109203519 AACTGCATTCAGGAGGCAATGGG - Intronic
936083029 2:109447948-109447970 AAATGCAGGCAGATGGCAGCAGG + Intronic
936538780 2:113333334-113333356 GCCTGCCTGCAGGAGGCAGAGGG - Intergenic
936733102 2:115407402-115407424 AACTGCTTCCTGAAGACAGAGGG + Intronic
937454741 2:122031659-122031681 AGCTGCATCCAGTAGGCAGAGGG + Intergenic
937720748 2:125092346-125092368 AATTGCATGCAGAAGCAACATGG - Intergenic
937875330 2:126820911-126820933 AACTGGAAGCAGAAGGCAAGAGG + Intergenic
941065964 2:160903116-160903138 ATAAGCATGAAGAAGGCAGATGG - Intergenic
942276442 2:174327098-174327120 GGCTGCGTGCAGCAGGCAGAGGG + Intergenic
943112919 2:183628537-183628559 AACTGGAGGAAGAAGTCAGAAGG - Intergenic
943182549 2:184561587-184561609 AGGTGCTTGCAGAAGGCAAAGGG + Intergenic
946020997 2:216640027-216640049 GACAGCATGGAGAAGGCAGGAGG - Intronic
946703493 2:222435862-222435884 AAGTGCTTGCTGAAGGCAAAGGG - Intronic
947616093 2:231557721-231557743 ATCTGCGTCCAGCAGGCAGATGG + Intergenic
947973243 2:234342334-234342356 AAATTCATGTAGAAGGCACAGGG - Intergenic
948380990 2:237549962-237549984 AACTGCCTGCAGAATGAAGTGGG + Intronic
948418316 2:237834121-237834143 AACTGCATCCAGAAGTCAGCAGG + Exonic
948701832 2:239765522-239765544 ATCGGCATGCAGAAGGCACTCGG - Intronic
1169801866 20:9518795-9518817 CTGTGCATCCAGAAGGCAGAGGG + Intronic
1170096342 20:12649757-12649779 AACAGGCTGCAGAAGGCAGGTGG - Intergenic
1170103050 20:12723102-12723124 AAATACACACAGAAGGCAGAAGG - Intergenic
1170339435 20:15306952-15306974 AACTTATGGCAGAAGGCAGAGGG + Intronic
1170747683 20:19115320-19115342 AACAGGAGGCAGAAGGTAGAAGG - Intergenic
1173302442 20:41816228-41816250 ATGTGGAAGCAGAAGGCAGAAGG - Intergenic
1173338621 20:42134481-42134503 AACTGGTGGCAGAAGGTAGAAGG + Intronic
1173674776 20:44824186-44824208 AAGGGCAAGCTGAAGGCAGATGG - Intergenic
1175084235 20:56445438-56445460 AAGTGCACGCAATAGGCAGAGGG - Intronic
1175476639 20:59280016-59280038 TTCTGCTTGGAGAAGGCAGATGG + Intergenic
1176596644 21:8704029-8704051 AGCTGCTTGCTGAAGGCAAAGGG - Intergenic
1177646301 21:23903683-23903705 AACAGCAAGGAGAAGGGAGAGGG + Intergenic
1178063061 21:28873472-28873494 AAGTGCTTGCTGAAGGCAAAGGG - Exonic
1178077541 21:29025555-29025577 TACTGCAGGCAGAGGACAGAGGG - Intronic
1178247064 21:30963455-30963477 AAATGCATGCAGTATGCATAGGG + Intergenic
1178475567 21:32934380-32934402 AACTGCCTGAAGAAGGGAGCCGG + Intergenic
1178764634 21:35438801-35438823 GCCTGCATGCAGAAGGCGAAAGG + Intronic
1180122694 21:45764583-45764605 AGCTGCAGGCTGAAGGCAGGGGG + Intronic
1180820289 22:18822510-18822532 ACCTGCATGCAGAAGCCACTGGG - Intergenic
1181206514 22:21256982-21257004 ACCTGCATGCAGAAGCCACTGGG - Intergenic
1181350044 22:22248424-22248446 GACTGCATGCAGCAGGAGGATGG - Intergenic
1181576143 22:23796428-23796450 AGCTGAATGCACAAGGTAGATGG - Intronic
1181820145 22:25469073-25469095 AATCCCATGCAGAAGTCAGAGGG + Intergenic
1182126802 22:27821821-27821843 AACAGCATGAAGAGGGCACAGGG - Intergenic
1182738436 22:32547954-32547976 AAGTGCAGACACAAGGCAGAGGG - Intronic
1183111609 22:35653599-35653621 GACAGAAGGCAGAAGGCAGAAGG + Intronic
1183256794 22:36767507-36767529 CTCAGCATGCAGAAGTCAGAGGG + Intronic
1183933003 22:41246799-41246821 CACGGTGTGCAGAAGGCAGAGGG - Intronic
1184115383 22:42418915-42418937 AGCTGGAGGCTGAAGGCAGAGGG - Intronic
1184938832 22:47745904-47745926 AAGTGCTTGCTGAAGGCAAAGGG - Intergenic
1185101989 22:48845498-48845520 AACTGCAGGGCAAAGGCAGACGG + Intronic
1203220406 22_KI270731v1_random:38441-38463 ACCTGCATGCAGAAGCCACTGGG + Intergenic
1203270419 22_KI270734v1_random:48385-48407 ACCTGCATGCAGAAGCCACTGGG - Intergenic
949336993 3:2985801-2985823 AAATACAAACAGAAGGCAGAAGG + Intronic
949606581 3:5660172-5660194 AAGTGCATGTAGAAGACACATGG - Intergenic
950183424 3:10930709-10930731 AGCTGCTTGGAGAAGGCAGGTGG + Intronic
950372180 3:12540362-12540384 AACTGCGTTCTGATGGCAGAAGG - Exonic
951239496 3:20272343-20272365 AGCTGCTTGAGGAAGGCAGAAGG - Intergenic
952159398 3:30678586-30678608 AACTGTGTGCAGAAGGATGATGG + Intronic
952632491 3:35486412-35486434 AACCCCAGGCAGAAAGCAGAGGG - Intergenic
952646458 3:35664756-35664778 AAGTGCCTGGAGGAGGCAGAAGG + Intronic
952813294 3:37424345-37424367 TCCTTTATGCAGAAGGCAGATGG - Intronic
953605540 3:44411015-44411037 TCCTGCCTGCAGCAGGCAGAAGG - Intergenic
953634732 3:44653106-44653128 AACTGCTTGCAAAAGGCATGCGG + Intronic
955401240 3:58593075-58593097 TCCTGCAGGCAGAAGGCAGTTGG - Intronic
956285629 3:67607137-67607159 AACTGCATTCCCAAGGCTGAAGG + Intronic
957101703 3:75836562-75836584 AACTACGTGAAGAATGCAGAAGG - Intergenic
957274103 3:78068170-78068192 AAGAGAAGGCAGAAGGCAGAAGG + Intergenic
957754848 3:84471389-84471411 AGGTGCATGCTGAAGGCAAAGGG + Intergenic
959044493 3:101457636-101457658 AACTGCTCGTAGAAGGAAGAAGG - Intronic
959195199 3:103171547-103171569 TATCTCATGCAGAAGGCAGAAGG + Intergenic
960354927 3:116639914-116639936 AACTGAATGGAAAAGGCATAAGG + Intronic
960735863 3:120779939-120779961 ATCAGAATGCAGAATGCAGATGG + Intronic
961822285 3:129581161-129581183 AACAGCAGGCAGCAGGCAGCGGG - Intronic
962413941 3:135165915-135165937 AGCTGTATGCAAAAGGCACATGG + Intronic
963226357 3:142866424-142866446 ACCAGCTTGCAGAAAGCAGATGG + Intronic
963453740 3:145517400-145517422 AAATGCTTGCTGAAGGCAAAGGG - Intergenic
964560997 3:157996520-157996542 AAGTGGAAGCAGAAGGCAGAAGG + Intergenic
964561097 3:157997421-157997443 AAGTAGAAGCAGAAGGCAGAAGG - Intergenic
964605163 3:158553122-158553144 AAATGCAACCAGAAGCCAGAGGG - Intergenic
964821397 3:160774236-160774258 ACTTGCATGAAGAAGGAAGAAGG - Intronic
966196291 3:177317230-177317252 AACTGCATCCATATGGCACAAGG - Intergenic
967080231 3:186043072-186043094 AACTGGATCCAGGAGTCAGATGG - Intergenic
967917234 3:194587817-194587839 AAATGCATGCAGAAGGTAAGAGG - Exonic
968604400 4:1525307-1525329 AAGTGCAACCAGAAGTCAGAAGG - Intergenic
968705656 4:2076212-2076234 AAGTGCAAGCACAAGGCGGACGG + Intronic
969311385 4:6354674-6354696 AACAGGGTGCAGAAGGCAGCTGG + Intronic
969436969 4:7193943-7193965 TGGTGCATGCAGGAGGCAGAGGG + Intronic
969592788 4:8131511-8131533 TTCTGCATGCGGAGGGCAGATGG + Intronic
970213379 4:13733550-13733572 AACCGCATGTGCAAGGCAGATGG + Intergenic
970817660 4:20177235-20177257 ATCTGTATGTATAAGGCAGATGG + Intergenic
972065614 4:34939514-34939536 TTCTGCAGGCAGAGGGCAGAGGG + Intergenic
973592509 4:52457353-52457375 AACTACATGAAGCATGCAGAAGG - Intergenic
973808432 4:54547626-54547648 AGGTGGAAGCAGAAGGCAGAAGG - Intergenic
974289825 4:59914686-59914708 AAGTGCTTGCTGAAGGCAAAGGG + Intergenic
974350533 4:60738878-60738900 TCCTGCATGCAGAAGGCAGATGG - Intergenic
974459275 4:62166201-62166223 AGGTGCTTGCTGAAGGCAGAGGG + Intergenic
975048014 4:69827508-69827530 AGCTGCTTGAGGAAGGCAGAAGG - Intronic
975386458 4:73765568-73765590 AAGTGCTTGCTGAAGGCAAAGGG - Intergenic
976996378 4:91438819-91438841 AACTACGTGAAGAATGCAGAAGG + Intronic
977229831 4:94438655-94438677 CATTGCAGGCTGAAGGCAGAAGG + Intergenic
977506025 4:97904795-97904817 AACTACGTGAAGAATGCAGAAGG + Intronic
978344240 4:107749753-107749775 AACTGCATGAAGAGGCCACATGG + Intergenic
978675380 4:111308585-111308607 AAAAGCATGCAGAAAGCTGAAGG - Intergenic
978746621 4:112202020-112202042 AACTGCTTACAAAAGGCAGGTGG + Intergenic
979595452 4:122529653-122529675 AAGTGCCTGCTGAAGGCAGAGGG - Intergenic
980897481 4:138874112-138874134 AGCAGCATGGAGAAGGCAGCTGG - Intergenic
980971202 4:139568775-139568797 CACAGCATGCAGAGGGCAGGCGG + Intronic
981072546 4:140559019-140559041 AACTGCATGCAGAAGAGATAGGG - Intergenic
983203230 4:164885023-164885045 TACAGCATGCAGAGGGAAGAGGG - Intronic
984256273 4:177393333-177393355 AGCTTCATGCAGAAGGAAGGCGG + Intergenic
984403718 4:179300308-179300330 AAGTGCTTGCTGAAGGCAAAGGG - Intergenic
984575203 4:181439565-181439587 AACAGCATGAGGGAGGCAGAAGG + Intergenic
985613110 5:901493-901515 AACTCCTTGCAGAAGGACGAAGG - Intronic
985830440 5:2224119-2224141 AGCTGCATGGAGAATTCAGATGG - Intergenic
986087398 5:4464843-4464865 AGCTGCTTGCTGAAGGCAAAGGG + Intergenic
986375795 5:7130077-7130099 AACTACATGAAGAATGCAGAAGG - Intergenic
986531134 5:8738392-8738414 AAGTGCTTGCTGAAGGCAAAGGG - Intergenic
986969210 5:13312614-13312636 AACTGAATGCAATAGGCAGAGGG + Intergenic
987151117 5:15041039-15041061 GACTGACTGCAGAAGGCAAATGG + Intergenic
988115210 5:26878648-26878670 AAATGCATTCAGGAGCCAGATGG - Intergenic
988880393 5:35495570-35495592 AACTACCTGAAGAATGCAGAAGG + Intergenic
988993926 5:36696383-36696405 AGCTGCATGGAGAAGGTAGGTGG - Intergenic
989442797 5:41492734-41492756 AACTACGTGAAGAATGCAGAAGG - Intronic
989456363 5:41648767-41648789 AATGGGATGCAGAAGGCAGAAGG - Intergenic
990116749 5:52399968-52399990 AGCTGCTTGAGGAAGGCAGAAGG - Intergenic
990357132 5:54979888-54979910 TGCTGCATCCAGAAGGCAAAAGG + Intronic
991202556 5:64010970-64010992 AACTGAGAGAAGAAGGCAGAAGG - Intergenic
992111918 5:73502490-73502512 AACTGCTCGCAGAAAGAAGAAGG + Exonic
993271642 5:85804906-85804928 AACTGAATGGAAAGGGCAGAAGG + Intergenic
993862952 5:93158522-93158544 AACATCATGCAGAGGCCAGAGGG - Intergenic
994231716 5:97315594-97315616 AGCTGCTTGAGGAAGGCAGAGGG + Intergenic
994512868 5:100729408-100729430 GAATGCATGCAAAAGGAAGAGGG - Intergenic
994691252 5:103022307-103022329 AACTGAAGGCTGAAGGCAAATGG - Intronic
995891177 5:116953675-116953697 AAATTCATCAAGAAGGCAGATGG + Intergenic
996277504 5:121685091-121685113 AATAGCCTGCAGCAGGCAGAAGG + Intergenic
997072412 5:130636269-130636291 AGCTGCTTGAGGAAGGCAGAAGG - Intergenic
997179769 5:131815860-131815882 AAGTGCCTGCTGAAGGCAGAAGG + Intronic
997386804 5:133480135-133480157 CCCCGCATGCAGTAGGCAGATGG + Intronic
997466181 5:134089601-134089623 CTCTGCATGCAGAAGGGAGCAGG - Intergenic
997727988 5:136138503-136138525 AACTGCACGCAGAGAGGAGAAGG - Intronic
998894805 5:146788086-146788108 AACGGCATGGAGGAGGCAGAGGG - Intronic
999041871 5:148422824-148422846 AATTGTTTGCAGTAGGCAGAGGG - Intronic
999111541 5:149125665-149125687 AACTGCAAGCAAAAGGCAGCAGG + Intergenic
999335266 5:150710691-150710713 AACGGAATGCAGAAAGCAGTTGG + Intronic
1000544295 5:162579367-162579389 AACTACGTGAAGAATGCAGAAGG + Intergenic
1000730697 5:164830219-164830241 AAGTGCTTGCTGAAGGCAAAGGG + Intergenic
1001211781 5:169816542-169816564 AACTGCAGGCAGAAAACAGTTGG - Intronic
1002734655 5:181376356-181376378 AACTTCATGCAGCATGCACAAGG - Intergenic
1002749876 6:97764-97786 AACTTCATGCAGCATGCACAAGG + Intergenic
1002956853 6:1873998-1874020 TACAGCTTGCAGGAGGCAGACGG + Intronic
1003045570 6:2730105-2730127 AACTACATGCTGCAGGCAGATGG - Intronic
1003805801 6:9724971-9724993 AGCTGCTTGAGGAAGGCAGAAGG - Intronic
1003937971 6:10995249-10995271 AACCACAGGCAGCAGGCAGAAGG - Intronic
1005008302 6:21311977-21311999 AACTACCTGGAGAAGGCAGAAGG - Intergenic
1006925697 6:37654089-37654111 AACTGCCAGCAGATGGCAGAAGG - Intronic
1007244392 6:40450016-40450038 AAATGGATACAGTAGGCAGAAGG + Intronic
1008814317 6:55545269-55545291 AACTGTATTCAGGAGGCATATGG - Intronic
1008930636 6:56935356-56935378 AGCTGCACGCAGCAGGCAGCAGG - Intronic
1009209717 6:60847583-60847605 TCCAGCCTGCAGAAGGCAGATGG - Intergenic
1010017690 6:71123325-71123347 GGCTGCAGGAAGAAGGCAGATGG - Intergenic
1010514233 6:76753583-76753605 AACTTCATGACGAAGGGAGAAGG + Intergenic
1010845733 6:80704445-80704467 AACTGAAACAAGAAGGCAGAGGG - Intergenic
1015095170 6:129407662-129407684 AGGTGCTTGCAGAAGGCAAAGGG - Intronic
1015279907 6:131421893-131421915 TACTGCATGAAGAAGTCACAGGG + Intergenic
1016147054 6:140690763-140690785 AGGTGCATGCTGAAGGCAAAGGG - Intergenic
1016998513 6:149977996-149978018 ACCTGCTTGCAGAAAGAAGAAGG + Intergenic
1017005752 6:150027216-150027238 ACCTGTGGGCAGAAGGCAGAGGG + Intergenic
1018337587 6:162810676-162810698 AGCAGAATGCAGTAGGCAGAAGG + Intronic
1018392448 6:163350766-163350788 AAATGGAGGCAGAAGCCAGAAGG + Intergenic
1018534756 6:164808464-164808486 AGGTGCTTGCAGAAGGCAAAGGG - Intergenic
1018833525 6:167465123-167465145 AACTGCATCCAGAAAGATGAAGG - Intergenic
1019014667 6:168871224-168871246 GACTGGATGCAGCAGGCTGATGG - Intergenic
1019238909 6:170648676-170648698 AACTTCATGCAGCATGCACAAGG - Intergenic
1020704771 7:11530686-11530708 GACTTCACGCAGAAGGCAAAAGG + Intronic
1020925073 7:14314470-14314492 AACTACGTGAAGAATGCAGAAGG + Intronic
1021017098 7:15548504-15548526 AACTACGTGAAGAATGCAGAAGG + Intronic
1021356576 7:19658368-19658390 AGCTGCTTGAGGAAGGCAGAAGG + Intergenic
1021580113 7:22143437-22143459 AACTGAATTGAGAAGGGAGAAGG - Intronic
1022190898 7:28016082-28016104 AACTGCATGCTGAAAGCTGCCGG + Intronic
1022590910 7:31661829-31661851 AACTGAAGGGAGTAGGCAGAGGG - Intergenic
1023883995 7:44338498-44338520 AAGGGCATGAAGAAGGAAGAGGG + Intergenic
1027630466 7:80598003-80598025 AACTGAAAGCAGAAAGCAGAAGG - Intronic
1027648550 7:80836251-80836273 AGCTTCATGTAGAAGACAGAAGG + Intronic
1028935281 7:96457007-96457029 AGCTGCTTGCTGAAGGCAAAGGG + Intergenic
1029371411 7:100153379-100153401 GACTGCATGCAGACGGAGGAGGG - Exonic
1029575545 7:101401140-101401162 ACCTGCCTGGAGAAGGCATAGGG + Intronic
1030272046 7:107679081-107679103 TACTGGATGTAGGAGGCAGAAGG + Intronic
1032236741 7:130130988-130131010 AACTCCATCGAGAAGGAAGAGGG - Exonic
1032539078 7:132688357-132688379 AAGTGGCTGCAGAAGGCAGTGGG - Intronic
1033564781 7:142567779-142567801 TAATGCAAGCAGACGGCAGACGG + Intergenic
1033878826 7:145856623-145856645 AACTACAAAGAGAAGGCAGATGG - Intergenic
1034669495 7:152847312-152847334 AACTGCCTGCTGAATGCAGTGGG + Intronic
1034947640 7:155273648-155273670 AGCAGAAGGCAGAAGGCAGAAGG + Intergenic
1035283473 7:157792194-157792216 CACACCTTGCAGAAGGCAGATGG - Intronic
1035508860 8:157933-157955 AACTTCATGCAGCATGCACAAGG + Intergenic
1035892195 8:3357194-3357216 AACTGCAGGCAAAATGCAAAAGG + Intronic
1036060882 8:5318966-5318988 AACTGCATCCAAAGTGCAGAAGG - Intergenic
1036270932 8:7302081-7302103 ACCTGCATTCTGAAGGCAAATGG - Intergenic
1036350417 8:8008263-8008285 ACCTGCATTCTGAAGGCAAATGG + Intergenic
1037497726 8:19456501-19456523 AACTGCATTCAGAACGCCGCAGG + Intronic
1038163283 8:25061052-25061074 AGATGCATCCAGAAGGCAGAGGG - Intergenic
1038691263 8:29765523-29765545 CACTTGAAGCAGAAGGCAGAAGG - Intergenic
1038955031 8:32458677-32458699 AACTGCTGGGAGAAGGGAGAGGG - Intronic
1039800521 8:40950660-40950682 ACGTGCATGGAGAAAGCAGAAGG + Intergenic
1040834945 8:51722071-51722093 AACTGCTTGCGGAAGGAAGAAGG - Intronic
1041191411 8:55359164-55359186 AAAAGCACGGAGAAGGCAGAAGG + Intronic
1041274193 8:56141305-56141327 AAGTGCTTGCTGAAGGCACAGGG - Intergenic
1043257056 8:78150251-78150273 AGCTGCTTGAGGAAGGCAGAAGG - Intergenic
1043421935 8:80106736-80106758 AAATGGACGCAAAAGGCAGAAGG + Intronic
1043546438 8:81320859-81320881 AGCTGCTGGCAGAAGGCAAAAGG - Intergenic
1044462356 8:92460239-92460261 AATTGCATCCGGAAGGCAGTAGG - Intergenic
1045858552 8:106791233-106791255 AGCTGCTTGAGGAAGGCAGAAGG - Intergenic
1046371249 8:113309797-113309819 AACAGCATGGAGAAGACTGAGGG - Intronic
1046794264 8:118353812-118353834 AAATGCATCCAGAAGCTAGAGGG - Intronic
1049400236 8:142423274-142423296 AACTGCAGGCAGAAGGCACAGGG + Intergenic
1051736985 9:20210450-20210472 ATCATCATGCAGAAGGCAGAAGG + Intergenic
1053385814 9:37687080-37687102 AACTGCATGAATATAGCAGAAGG - Intronic
1054967857 9:71050075-71050097 AACTGGACCCAGAAGACAGAAGG + Intronic
1055014972 9:71606401-71606423 AAGAGAATGCAGAAGACAGAAGG + Intergenic
1057049606 9:91913768-91913790 AAATGCATACAGAAAGTAGAGGG + Intronic
1057274444 9:93668835-93668857 AACTGCCTGCAGCGGGCTGAGGG - Intronic
1057917370 9:99067086-99067108 CAATGCATGCAGAAGGCAATGGG - Intronic
1058595900 9:106615386-106615408 AAATGCATTCAGAAGACAGGGGG - Intergenic
1058800918 9:108543691-108543713 AACTCCATGCAGAAGGCACATGG - Intergenic
1060492016 9:124092015-124092037 TGCTGCATGAAGGAGGCAGAAGG + Intergenic
1060775159 9:126367573-126367595 AAAAGCAAGCATAAGGCAGAAGG - Intronic
1062347932 9:136123993-136124015 GGCAGCATGCAGGAGGCAGAGGG - Intergenic
1062759114 9:138328966-138328988 AACTTCATGCAGCATGCACAAGG - Intergenic
1186087838 X:6010441-6010463 TACTTAATGCAGAAGGCAGTAGG - Intronic
1187030186 X:15478777-15478799 AAGTGTGAGCAGAAGGCAGAGGG - Intronic
1190124930 X:47695874-47695896 AAGTGAAATCAGAAGGCAGAAGG - Intergenic
1190177633 X:48164766-48164788 AACTGGATGAAGAAGGCCCACGG + Intergenic
1190523064 X:51299455-51299477 AACTGCATGTAGAAAGGGGAGGG + Intergenic
1190666235 X:52698188-52698210 AACTGGATGAAGAAGGCCCATGG - Intronic
1190673183 X:52760222-52760244 AACTGGATGAAGAAGGCCCATGG + Intronic
1191286662 X:58741060-58741082 AACTTCATGTAAAAGGCAAACGG + Intergenic
1191310235 X:59055133-59055155 AACTTCATGTAAAAGGCAAACGG + Intergenic
1191448493 X:60905027-60905049 AACTTCATGTAAAAGGCAAACGG + Intergenic
1191471152 X:61208445-61208467 AACTGCATATAAAAGGCAAACGG + Intergenic
1191476968 X:61286617-61286639 AACTTCATGTAAAAGGCAAACGG + Intergenic
1191547289 X:62227213-62227235 AACTTCATGTAAAAGGCAAACGG + Intergenic
1191899078 X:66022615-66022637 TTCTGGAAGCAGAAGGCAGATGG + Intronic
1193887260 X:86997567-86997589 AACTGCTTGAAAAAAGCAGAGGG - Intergenic
1194482847 X:94448010-94448032 ACATGCATGCTGAAGGCAAAGGG + Intergenic
1195782076 X:108477940-108477962 AGCTGCTTGCTGAAGGCAAAGGG - Intronic
1197420144 X:126228307-126228329 AAGTGCTTGCTGAAGGCAAAGGG + Intergenic
1198075636 X:133190581-133190603 AACTGAAGGCAGAAGTCAGGAGG + Intergenic
1198731829 X:139739261-139739283 AACTGGATGCATTAGTCAGAAGG - Intronic
1201687251 Y:16719322-16719344 TACTTTATGCAGAAGGCAAAAGG - Intergenic
1202327412 Y:23705801-23705823 AACTACATGAAGAATGCAGAAGG + Intergenic
1202543358 Y:25964251-25964273 AACTACATGAAGAATGCAGAAGG - Intergenic