ID: 905294670

View in Genome Browser
Species Human (GRCh38)
Location 1:36946693-36946715
Sequence CTGTGAAATGAGAAGGTGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 307
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 281}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905294670_905294676 -2 Left 905294670 1:36946693-36946715 CCATGCACCTTCTCATTTCACAG 0: 1
1: 0
2: 1
3: 24
4: 281
Right 905294676 1:36946714-36946736 AGATGAGGGATCGGAGGCAGAGG 0: 1
1: 0
2: 1
3: 58
4: 705
905294670_905294675 -8 Left 905294670 1:36946693-36946715 CCATGCACCTTCTCATTTCACAG 0: 1
1: 0
2: 1
3: 24
4: 281
Right 905294675 1:36946708-36946730 TTTCACAGATGAGGGATCGGAGG 0: 1
1: 0
2: 35
3: 456
4: 3224
905294670_905294677 24 Left 905294670 1:36946693-36946715 CCATGCACCTTCTCATTTCACAG 0: 1
1: 0
2: 1
3: 24
4: 281
Right 905294677 1:36946740-36946762 ATCCAATAACTCACCCATCATGG 0: 1
1: 0
2: 0
3: 2
4: 91

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905294670 Original CRISPR CTGTGAAATGAGAAGGTGCA TGG (reversed) Intronic
900641931 1:3691668-3691690 CTGCTAATTGAGAAGGTGGAAGG + Intronic
901021336 1:6257484-6257506 CTCTTAGAGGAGAAGGTGCAGGG - Intronic
902148865 1:14426147-14426169 CCATGAAATGAGAAGGTGCTTGG - Intergenic
902561871 1:17282705-17282727 CTGTGCAATGAGAAGGTAACTGG - Intronic
905198585 1:36300863-36300885 CTGTGAAAAGAGAAGAGCCAGGG - Intronic
905294670 1:36946693-36946715 CTGTGAAATGAGAAGGTGCATGG - Intronic
905300525 1:36983536-36983558 CTGTGAAATGAGAATGATGATGG - Intronic
905685263 1:39902756-39902778 GTGTGAGATGAGAGGGAGCATGG - Intergenic
908486572 1:64600089-64600111 CTGTGAAATGGGTAGGAGAAAGG + Intronic
908520423 1:64935992-64936014 TTGTGAAATGGGGAGGGGCAAGG - Intronic
911046905 1:93636223-93636245 CTGTGAAGGGAGAAGCTGCAGGG + Intronic
911295592 1:96110993-96111015 ATTTGAAAGGAGAAGGTACAAGG + Intergenic
913286380 1:117230433-117230455 CTGTAAAATGGGAATGAGCATGG + Intergenic
914222100 1:145690307-145690329 CTATGAAATGGAAAGGTGTAGGG - Intronic
915906750 1:159884320-159884342 TTGTGAAATGAGCATGTGCCTGG + Intronic
923252488 1:232190430-232190452 CAGCGAAACGAGATGGTGCAGGG - Intergenic
923361845 1:233219368-233219390 CTGTGAGAGGATAAGATGCAGGG + Intronic
924154363 1:241160916-241160938 GTGTGAAATCAGAAGGAGTATGG + Intronic
1064896252 10:20240573-20240595 CTGTTAAATCTGAAGCTGCAGGG - Intronic
1065603475 10:27392983-27393005 CTGTGACAGGAGGAGGTCCAGGG + Intergenic
1065713723 10:28543762-28543784 CTCTTAAATGAGAAGATACAAGG - Intronic
1066009108 10:31177290-31177312 CAGTGAAGGGAGAAGGTGGAGGG - Intergenic
1067720237 10:48722589-48722611 CAGTGGAATGGGAAGTTGCATGG + Intronic
1069496184 10:68905450-68905472 CTGTGAATTGTCAAAGTGCAGGG + Intronic
1072202572 10:93174294-93174316 CTGTGAAATTACAAAGTTCATGG - Intergenic
1072616555 10:97053317-97053339 ATGTGAAATTAGAGGGTACAGGG - Intronic
1073120644 10:101120869-101120891 CTGTGCTCTGAGAATGTGCAGGG + Intronic
1074298966 10:112216000-112216022 CTGGGAACTAAGAAGGTGTAGGG + Intergenic
1074696908 10:116058082-116058104 CAGCGAACTGAGAAGGTCCAGGG + Intronic
1075317248 10:121462698-121462720 TTGGGAAATGAGAAGGAGAATGG + Intergenic
1076231831 10:128826173-128826195 CTGTGAAATCACAAAGTGCCTGG + Intergenic
1077176614 11:1193995-1194017 CTGTGAGATGAGACGGTGGGGGG + Intronic
1077303590 11:1858114-1858136 CTGTGAAATGGGAGGCTCCAGGG - Intronic
1079524213 11:21364812-21364834 CAGGGAGATGAGAAGGTGAAGGG + Intronic
1080902538 11:36509883-36509905 CTGTGAAAAGCGAAGGGACAGGG + Intronic
1082655431 11:55850481-55850503 CAGTGAAGTCAGAAGGTGAACGG + Intergenic
1082675507 11:56096217-56096239 CTTTGAAATAAGAAATTGCAAGG + Intergenic
1083110199 11:60398906-60398928 TTGTGAAATGAGAAAGTGAGGGG - Intronic
1083272693 11:61580305-61580327 CTGTGAATTGAGAGGGTGCCAGG - Intronic
1085052402 11:73386596-73386618 GTGCGTAATTAGAAGGTGCAAGG + Intronic
1085324011 11:75592898-75592920 CTGTAAAATGGGAAGGAGCAGGG - Intronic
1085897312 11:80655530-80655552 CTGTGAAATAAGAAGGTCTAAGG + Intergenic
1085923803 11:80990557-80990579 CAGTGCTATGAGAAGGGGCAAGG - Intergenic
1087947362 11:104179172-104179194 ATTTGAAATAAGAAGGTACAAGG - Intergenic
1088219460 11:107552872-107552894 CAGTAAAATGAGAAGCAGCATGG + Intronic
1088464459 11:110119565-110119587 CTGTGAGATGAGAGTGTGCATGG - Intronic
1089187087 11:116625442-116625464 CTGTGGAAGGATAAGGTGGAAGG + Intergenic
1091052163 11:132382450-132382472 CTGTGGAAGGAAGAGGTGCATGG + Intergenic
1091140671 11:133231832-133231854 TTGTCAAAGGAGAAGGGGCAAGG + Intronic
1091662614 12:2395863-2395885 TTGAGAAATTAGAAGGTGCTAGG + Intronic
1091667074 12:2426877-2426899 GTGTGAGAGGAGAAGCTGCAAGG + Intronic
1091730882 12:2879245-2879267 CTGTGAAAGGTGAAGGTGGGAGG - Intronic
1091746724 12:2997521-2997543 GTGTGAAATGAGAAAGGGCAGGG + Intronic
1092836510 12:12494129-12494151 TTGTAAAATGAAAATGTGCAAGG - Intronic
1093558480 12:20508126-20508148 CAGTGCAATGAGAATGTGCCTGG - Intronic
1094174786 12:27530287-27530309 CTGGGAAGTGAGAGGGTGGAAGG + Intronic
1094335601 12:29347482-29347504 CTATGATATGAGAAAGGGCATGG - Intronic
1095301297 12:40587077-40587099 CTGAAAGATGAGAAAGTGCAGGG + Intergenic
1097716465 12:62971613-62971635 CTGAGAAATGAAAAGGTTGAGGG - Intergenic
1099786297 12:87268436-87268458 CTGGGAAATGAAAAAGTGAAAGG + Intergenic
1102004565 12:109581019-109581041 CTGTGGGATAAGGAGGTGCACGG + Intronic
1102197906 12:111037187-111037209 CTGTGATGTGAGGAGGTGCGTGG + Intronic
1102427301 12:112854010-112854032 CTGTAAAATGGGAAGTTGGATGG + Intronic
1103843945 12:123888265-123888287 CTGTGAAATGAGGATGTTAATGG - Intronic
1106318715 13:28618522-28618544 CTTTTACATGAGAAGTTGCAGGG - Intergenic
1107325441 13:39237081-39237103 CTCTGTAGTGAGAAGGAGCATGG + Intergenic
1109577007 13:64272597-64272619 CAGTGAGATGTTAAGGTGCAGGG + Intergenic
1111598521 13:90441991-90442013 GTGTGAAAGGAGAAGGAGGAGGG - Intergenic
1112201372 13:97279225-97279247 CTTTGAAATCAGAAGGACCAGGG + Intronic
1112490450 13:99858471-99858493 TTATTAAATGAGAAAGTGCAGGG + Intronic
1112561524 13:100519556-100519578 CTGTCAAAGGAGCACGTGCAAGG - Intronic
1113139546 13:107131854-107131876 CTGTGCATTTGGAAGGTGCAGGG - Intergenic
1113599192 13:111556226-111556248 CAGTGAAAGTAAAAGGTGCACGG - Intergenic
1114340827 14:21741521-21741543 CTCTGAAATGAGGAGTTTCATGG - Intergenic
1114441129 14:22748902-22748924 CTGTCAAAGGAGAAGGGGCACGG + Intergenic
1114722776 14:24899921-24899943 CTCTGAAGTGAGAAGGTCCTTGG + Intronic
1116256927 14:42569096-42569118 CTGTAAAATGGGAAGGTCTATGG - Intergenic
1117846593 14:59918723-59918745 CTGTGAAATAAGAATGTAGAGGG + Intergenic
1118004589 14:61554027-61554049 ATGTAAAATGAGAAGTTACAGGG - Intronic
1119866395 14:77978638-77978660 CTGTGAAATGAGAGAATGGATGG + Intergenic
1121549360 14:94787212-94787234 CTTTGAACTGAGCAGGTGCCCGG + Intergenic
1123583697 15:21738553-21738575 GTATGCAATGAGAGGGTGCAGGG + Intergenic
1123620347 15:22181156-22181178 GTATGCAATGAGAGGGTGCAGGG + Intergenic
1124100695 15:26690083-26690105 CTGGAGAATGAGAAGGTACACGG + Intronic
1125425087 15:39540484-39540506 CTATCAAAAGAGAAGGTGAAAGG + Intergenic
1126314582 15:47356628-47356650 CTGTGAAATGAGAGGGATGAAGG - Intronic
1126813113 15:52428689-52428711 CTGTGATATTGGAAGGTGCTAGG - Intronic
1126995599 15:54440183-54440205 CTGTCATGTGAGAAGGTCCAAGG + Intronic
1129156140 15:73719394-73719416 CCGTGAAAGGAGAAGGGGGAGGG - Intergenic
1130106215 15:80930568-80930590 ATGTGAAATGAAAAAATGCATGG + Intronic
1130403778 15:83580400-83580422 CTGTCAAATGAGTGGCTGCAAGG + Intronic
1130444513 15:83987846-83987868 CTATGAAGTGAGATGGGGCAGGG + Intronic
1130751468 15:86717563-86717585 CAGTGAAATGTGAAGGTTCTGGG - Intronic
1131828200 15:96336548-96336570 CTTTGAAATGAGAAGCTTCTTGG - Intronic
1136255001 16:29032637-29032659 CTTTGAAGAGGGAAGGTGCAGGG + Intergenic
1137748487 16:50841129-50841151 CTGGGAAAGGAGAAGTTGGAAGG + Intergenic
1137757437 16:50913864-50913886 CTTTAAAATGAGAAGGTGGAGGG + Intergenic
1137922564 16:52505218-52505240 TAGTGAAATGAGAAGGTTCAGGG - Intronic
1139037957 16:62970504-62970526 CTGAGAAGTTTGAAGGTGCATGG + Intergenic
1139197525 16:64938053-64938075 ATTAGAAATGAGTAGGTGCAGGG - Intergenic
1141041888 16:80679635-80679657 TTGTGAAATGAAAAGCTGTAAGG - Intronic
1141305544 16:82859909-82859931 GTCTGTAATGACAAGGTGCAGGG + Intronic
1141980105 16:87544943-87544965 ATGACAAATGAGAAGGTGCCCGG - Intergenic
1142139264 16:88465463-88465485 CTGTCAAATGAGTGGGAGCACGG + Intronic
1142262620 16:89049989-89050011 CTGTGAAATTCGGAGGTGGAGGG + Intergenic
1145128106 17:20318333-20318355 TTTTGAAATGAGAAGGGGCTAGG - Intronic
1148353514 17:46958237-46958259 CTGTAAAATGTGAAGGTTGACGG - Intronic
1148587691 17:48792431-48792453 GTGTGGAAGGAGGAGGTGCAGGG + Intronic
1149140544 17:53428245-53428267 CTGTGATGGGAGAGGGTGCAAGG - Intergenic
1150054523 17:62001326-62001348 CTGGGAAATTAGAAGTAGCAGGG - Intronic
1150362165 17:64545836-64545858 CTGTGGAATGACAAGCTTCAAGG - Exonic
1150626906 17:66847790-66847812 CTCTGCAATGAAGAGGTGCAAGG - Intronic
1151670264 17:75568400-75568422 CTGTGGAATCAGAAGCTCCAGGG - Intronic
1151750592 17:76035225-76035247 CTTTGAAATGAAACGGTGCTGGG - Intergenic
1151831126 17:76551895-76551917 CTGTGAAATGGGAAGGTGGGGGG + Intronic
1152076096 17:78160932-78160954 CTGGGAGATGAAAAGGTCCAAGG - Intronic
1152450577 17:80376709-80376731 CTGTGAAATAACAAAGGGCAAGG - Intronic
1155120608 18:22815753-22815775 CTGAGGAATGAAAATGTGCAAGG + Intronic
1155137472 18:23010239-23010261 ATATGAAAAGAGAATGTGCAAGG - Intronic
1155835636 18:30580531-30580553 TTTTGAAAATAGAAGGTGCATGG + Intergenic
1156794632 18:41028709-41028731 CTGAGAAATGCAGAGGTGCAGGG - Intergenic
1160344311 18:78120208-78120230 CTGTGATATGAGAAGGAATAAGG + Intergenic
1160352105 18:78192332-78192354 CTGTGAAATGCTCAAGTGCAGGG - Intergenic
1161401924 19:4069783-4069805 GGGAGAAATGAGACGGTGCATGG + Intergenic
1162119422 19:8453680-8453702 CTGGGGAAGCAGAAGGTGCAAGG + Intronic
1162192200 19:8955760-8955782 CTGTGGACTGAGAAGGGCCAGGG + Exonic
1162513198 19:11132127-11132149 CTCTGAACTGAGAAAGTGCAAGG - Exonic
1162585155 19:11553855-11553877 CTGTGGGGTGAGAAGATGCAGGG - Intronic
1162856315 19:13471119-13471141 CTTTTATATGAGAAGGTACAGGG - Intronic
1162873771 19:13605752-13605774 CTGTGAAATGGGAAGAAGAATGG - Intronic
1163664833 19:18598340-18598362 AGGAAAAATGAGAAGGTGCAGGG + Intronic
1163989611 19:20986068-20986090 CTGAGAAACAAGAAGATGCAGGG + Intergenic
1167523266 19:49969527-49969549 CTGTGAAAGGAGAAGTTGGGAGG + Intergenic
1167891282 19:52541738-52541760 CTGTGAGATGATAAGGTTCAAGG - Intronic
1167920724 19:52781092-52781114 CTGTGAGATGATAAGGTTCAAGG + Intronic
1167945164 19:52982307-52982329 CGGTGAGATGATAAGGTTCAAGG + Intergenic
1168379076 19:55905113-55905135 CTGTGGAAGGTGCAGGTGCAAGG + Intronic
925296553 2:2781024-2781046 GTGTGAACTCTGAAGGTGCAGGG - Intergenic
925670914 2:6309112-6309134 CTGAGATGTGAGAAGGAGCAGGG - Intergenic
927061653 2:19428588-19428610 CTGTGAAATGAGAATTTAAAAGG - Intergenic
928493854 2:31811992-31812014 CTGTAAAATGAGATCTTGCAGGG + Intergenic
929657223 2:43745915-43745937 CTGGAAAATGTGAAGGTACAAGG + Exonic
929836343 2:45404167-45404189 CTCTGAACTGAGAAGCTGAAAGG + Intronic
930018969 2:46989500-46989522 CTGAGAAATGAGAAAGCACACGG - Intronic
932301392 2:70669735-70669757 CTGTGAAAATAGAAGTTGCTAGG - Intronic
932716020 2:74101225-74101247 CTGTGAAGTGGGAAGGGGCCAGG - Exonic
935560937 2:104559168-104559190 CAATGAAATGAGAAAGTGCTGGG + Intergenic
936460419 2:112710267-112710289 CTGGGAGATGACAAGGTCCAAGG - Intergenic
937352932 2:121178468-121178490 CTGTGCAGTCAGAAGGTGCCTGG + Intergenic
937568234 2:123323369-123323391 CAGTTAAAGGAGAAAGTGCATGG + Intergenic
937770239 2:125712384-125712406 CTGTGAAATGGGAATGTTAATGG + Intergenic
938579435 2:132633149-132633171 AGGTGAAATGACAAGGGGCAGGG - Intronic
939321187 2:140624946-140624968 CTCTGAAATGAGAATGTTTAGGG + Intronic
939816428 2:146902512-146902534 TAATGAAATGAGAAGGTGAAGGG - Intergenic
941897574 2:170644924-170644946 ATATGAAATCAGAAGGTGCAGGG + Intronic
942512289 2:176715332-176715354 CTGTCAAATGATAATGTTCATGG + Intergenic
943262329 2:185682099-185682121 GTGTGGAATGAGATAGTGCAGGG - Intergenic
943329895 2:186546606-186546628 CTGGGAAATGAGAAAGTGATTGG - Intergenic
1171201838 20:23247945-23247967 CTGTGAAAGGAGGAGGGGGACGG + Intergenic
1171258266 20:23708523-23708545 CTCTGACATGAGCAGGTGGATGG - Intergenic
1171275489 20:23853566-23853588 CTCTGACATGAGCAGGTGGATGG - Intergenic
1171333874 20:24365673-24365695 TTGTGAAATGAGAAAGTGATAGG + Intergenic
1172035752 20:32009974-32009996 GTGAGAAATGAAAAGGTGGATGG - Intergenic
1172049843 20:32109162-32109184 CTGTGAAATGGGAAGGGGGTTGG - Intergenic
1173955866 20:47032089-47032111 CTCTGAACTGAGGAGTTGCAGGG - Intronic
1174392047 20:50223729-50223751 TTGGGAAATGGGAAGATGCAGGG + Intergenic
1175703572 20:61158424-61158446 CAGTGACATGACAAGATGCAGGG + Intergenic
1176124893 20:63471010-63471032 CTGTGATATGAGAGGGTTCTGGG - Intronic
1180186142 21:46140312-46140334 CTGAGCAATGCGAAGGTGGACGG - Intronic
1180186183 21:46140513-46140535 CTGAGCAATGCGAAGGTGGACGG - Intronic
1181913262 22:26257357-26257379 CTGTAAAATGAGAAGTTAAATGG - Intronic
1182329647 22:29542047-29542069 CTGAGAGATGAGAAGGAGGAAGG - Intronic
1183426803 22:37744381-37744403 CTGTCAAATGAGAATCTGGAAGG + Intronic
1184321208 22:43743507-43743529 CTGTGAAATGAGAATGAATAAGG + Intronic
1185080092 22:48704936-48704958 CTGTGTCCTGAGATGGTGCAGGG + Intronic
951184458 3:19696413-19696435 TTTTGAAATCAGAAAGTGCAAGG - Intergenic
952678993 3:36069267-36069289 CTTATAAATGAGAACGTGCAGGG + Intergenic
952782939 3:37121692-37121714 CTGGGAAAGGAGAAAGTACATGG + Intronic
954830960 3:53420945-53420967 CTGTGCAATCACAAGGTTCAGGG + Intergenic
955820739 3:62893124-62893146 CTGTGACCTGAAAAGGTGGAAGG + Intergenic
956345919 3:68278670-68278692 CTGTGCTAAGAAAAGGTGCAAGG - Intronic
957253522 3:77806640-77806662 CTGGGATCTGAGAAGGTGAAAGG - Intergenic
957512061 3:81201781-81201803 CAGTGAAGAGAGAAGGGGCAGGG + Intergenic
958266753 3:91446809-91446831 CTGTGAAATGAAAAATTACAGGG - Intergenic
958735853 3:98008740-98008762 CTGTTAAAGGAGAAGGTTCAGGG - Intronic
958962358 3:100522409-100522431 CTGTGAATTCAGAAGGAGGATGG - Intronic
959061177 3:101617908-101617930 CAGTGAAGGGAGAAGGTGCATGG - Intergenic
961864825 3:129945997-129946019 CTGTGAAATGGGAGGGTGAATGG - Intergenic
962158903 3:132978345-132978367 CCGTGAAATCAGAATGTGCATGG + Intergenic
963461688 3:145622456-145622478 CTGTGGAATGAAGAGGTGAAAGG - Intergenic
966549922 3:181193594-181193616 GTTGGAAATGAAAAGGTGCATGG + Intergenic
967887503 3:194343070-194343092 CTGTGCAAAGAGCAGGTGCCAGG - Intronic
968003354 3:195222648-195222670 CAGGGAAATGAGAAAGTGAACGG + Intronic
968665855 4:1822049-1822071 CAGTGAGAGGAGATGGTGCAAGG - Intronic
970066265 4:12097256-12097278 CTTTGAAATGAGAACATTCAAGG - Intergenic
970429376 4:15974789-15974811 CAGTGCAAAGAGAAGGTGCTAGG - Intronic
971311547 4:25529749-25529771 CTGTCAAATGGGAAGGCTCATGG - Intergenic
971365404 4:25972975-25972997 CTGTTAAATGATTAGGGGCATGG - Intergenic
972501712 4:39683980-39684002 CTTTGAAAGGCTAAGGTGCATGG - Intergenic
972665395 4:41160310-41160332 GAGTGAAATGGGAATGTGCATGG - Intronic
973156333 4:46958535-46958557 CTAAGAAATGAGAATGTGAAAGG + Intronic
973221394 4:47731177-47731199 CTGGGAGAAGAGAAAGTGCATGG + Intronic
973856817 4:55019733-55019755 CTGGGAGGTGAGAAGGAGCAAGG - Intergenic
974065168 4:57070976-57070998 GTGTGCAATGAATAGGTGCAGGG - Intronic
975707240 4:77123142-77123164 CTGTGTAATGAGGAGGTCCTGGG + Intergenic
976961627 4:90983015-90983037 CTGGTAAATGAGAAGGTCTAAGG - Intronic
980835708 4:138189296-138189318 TTGTGGAATGAGAAGGAGCATGG + Intronic
980979336 4:139640855-139640877 CTGTGAAAGGAGATAGTGCTTGG + Intergenic
981386787 4:144141022-144141044 ATTAGAAATGAGAAGGTCCATGG - Intergenic
981641363 4:146946984-146947006 CTGTGAGAAAGGAAGGTGCATGG - Intergenic
982487599 4:155985998-155986020 CTTTCAAATGAACAGGTGCATGG - Intergenic
985290208 4:188379029-188379051 CTGTGATATGAGAAAATACAGGG - Intergenic
985940622 5:3132923-3132945 AGGTCAACTGAGAAGGTGCAGGG + Intergenic
986363979 5:7011100-7011122 TTCTGAGATGGGAAGGTGCAGGG + Intergenic
986696888 5:10365104-10365126 CTGTGAGATCAGAAGAAGCAGGG - Intronic
987074320 5:14366612-14366634 ATGGGAAATGAAAAGGTGGAGGG - Intronic
988622641 5:32839329-32839351 CTGTGAGATGGCAAGCTGCAAGG + Intergenic
988847949 5:35148455-35148477 ATGTGAGCTGAGAAGGGGCAAGG + Intronic
990192511 5:53275736-53275758 CTGTAAAAAGAGAACTTGCAGGG + Intergenic
990415789 5:55585271-55585293 CTGTGCAAGAAGCAGGTGCAGGG + Intergenic
993635067 5:90333131-90333153 CTGTGAAATGAGAATGTTAAAGG - Intergenic
996314172 5:122142627-122142649 CTGGGAAATGAGAATTTGTAGGG + Intronic
997523546 5:134538426-134538448 CAGTGGAATGAGAAGCAGCAGGG + Intronic
999305780 5:150518510-150518532 TTGTGAAATGAGGAGGTGACTGG - Intronic
999439243 5:151588860-151588882 GTGAGAAATGAGGGGGTGCATGG - Intergenic
999639338 5:153655952-153655974 ATGTGAACTGAGTAGGTGGAAGG + Intronic
1000954919 5:167531896-167531918 CTGTGAAAAGACAACGTGCTGGG - Intronic
1001838216 5:174850557-174850579 CTGTTGAATGAGGAGGTGCGTGG - Intergenic
1002055075 5:176594101-176594123 CTGTGGACTGGGAAGGGGCAGGG + Intronic
1002393837 5:178938094-178938116 GGAGGAAATGAGAAGGTGCAGGG + Intergenic
1003954710 6:11151013-11151035 CTGTGAAAAGAGGAGGTGGTGGG - Intergenic
1004845074 6:19632351-19632373 ATTTGAAATGAAAAGCTGCATGG + Intergenic
1004996376 6:21197506-21197528 ATATGAAATGTGGAGGTGCAAGG + Intronic
1006927074 6:37662676-37662698 GTGAGGAATGAGAAGATGCAAGG + Intronic
1007256775 6:40535223-40535245 CTGTCAAATGAGATGATGAAAGG + Intronic
1007285688 6:40745875-40745897 CTGGGAAATGTGAGGTTGCAGGG - Intergenic
1008549626 6:52615239-52615261 CTGTGAAAAAATATGGTGCATGG + Intergenic
1008988457 6:57574785-57574807 CTGTGAAATGAAAAATTACAGGG + Intronic
1009177066 6:60473375-60473397 CTGTGAAATGAAAAATTACAGGG + Intergenic
1012971389 6:105735517-105735539 GTTTGGAATGAGAAGGGGCATGG + Intergenic
1013317603 6:108957261-108957283 CTGTGTAAGGGGAAGGTGGAGGG - Intronic
1013855074 6:114562739-114562761 CTGTGGTTTGAGAAGGTGCAGGG + Intergenic
1014664825 6:124223940-124223962 GTTTAAAATGAGATGGTGCATGG + Intronic
1015788841 6:136945953-136945975 CAGTGAAATGAGAACGTGGGTGG - Intergenic
1016671210 6:146710781-146710803 CTGAAAAATGAGGAGGTGTAGGG - Intronic
1018251529 6:161876554-161876576 CTTTGAAATGCGAAGGAGAAAGG - Intronic
1020563995 7:9773090-9773112 CTGGGAAAAGAAAATGTGCATGG - Intergenic
1021847419 7:24776295-24776317 CTTCAAAATGAGAAGATGCAGGG + Intergenic
1022641565 7:32190271-32190293 CTGTGAAATGTGCAAGTCCAGGG - Intronic
1023891842 7:44398429-44398451 CTGGAAAATGAGAACGTGCCAGG - Intronic
1024107908 7:46111540-46111562 ATATGAAAAGAGAAGATGCATGG - Intergenic
1024554079 7:50588302-50588324 CTGGGAAATGGGATGGGGCAGGG + Intergenic
1024852787 7:53741026-53741048 CTGTGGCATCAGTAGGTGCAGGG - Intergenic
1024928594 7:54645150-54645172 ATGTGGAATGAGAAGGAGAAGGG + Intergenic
1025911922 7:65835950-65835972 CTGTGAAATGTGAGTATGCATGG + Intergenic
1026185786 7:68081864-68081886 CTGTGAAGAGAGAAGGTGGTGGG + Intergenic
1026189642 7:68113028-68113050 CTGTGAAATGTGAAAATGAATGG + Intergenic
1028089504 7:86680765-86680787 ATGTGAAATGGGAAGGGGCTGGG - Intronic
1029150431 7:98476603-98476625 CTGAGAAATGAGAGGGAGCAGGG - Intergenic
1029953440 7:104611637-104611659 CTTGGAAATGAGAAGATGAAGGG - Intronic
1029974987 7:104825348-104825370 CTGTGAAAAGAGAAGCAACATGG + Intronic
1031290487 7:119928363-119928385 CTGTGGATTCAGAAGGTGCCAGG + Intergenic
1031639436 7:124143492-124143514 ATGTGAAAAGAGAAAGTCCAAGG + Intergenic
1032265910 7:130369883-130369905 CTGTGAAAGGAGATAGTGCTTGG + Intergenic
1032768737 7:135026196-135026218 CTGTGATGTGAGAATGTGCTTGG - Intronic
1033596366 7:142862491-142862513 CTGATAAATGAGACAGTGCAGGG - Intronic
1033987288 7:147241726-147241748 CATTGAAATGAGGAGTTGCAAGG - Intronic
1035109242 7:156466712-156466734 CAGTGAAGTGAGAGGGTGCGGGG + Intergenic
1035286804 7:157812027-157812049 GTGAGAAATGAGGAGGTTCAGGG + Intronic
1036168463 8:6459831-6459853 CTGAGTAATGTGAAGGTGCCAGG + Intronic
1036681072 8:10874703-10874725 CTTGGAAATGAGAAGGAGAAAGG - Intergenic
1039978000 8:42383495-42383517 CTGTGCAATGTGCTGGTGCAGGG + Intergenic
1041971035 8:63742872-63742894 TTGAGAAAGGAGAACGTGCAAGG - Intergenic
1045410116 8:101908793-101908815 CTGTAAAGTGATAATGTGCATGG + Intronic
1046394006 8:113615565-113615587 TGTTGAAATGTGAAGGTGCAGGG + Exonic
1048750529 8:137668616-137668638 CTGGGAACTGAGAAGGTTGAAGG + Intergenic
1049377753 8:142297054-142297076 CTGTGAAGTGGGCAGGTGGAAGG - Intronic
1049397515 8:142408164-142408186 CTGTGGAATGAGGAGGAGCCAGG - Intergenic
1051416850 9:16850624-16850646 CTGTGGAAGGTGAAGGTGGAAGG + Intronic
1052242844 9:26295368-26295390 CTTTGAAATTAGATGGTGCTTGG + Intergenic
1053753317 9:41277642-41277664 CTGTGATCTGAGACAGTGCATGG + Intergenic
1054332935 9:63778035-63778057 CTGTGATCTGAGACAGTGCATGG - Intergenic
1055159504 9:73108340-73108362 ATGAGAAAAGAGAAGGTGAACGG - Intergenic
1055185291 9:73444556-73444578 CTGGGGATTGAGAAGGTGTATGG + Intergenic
1055709616 9:79045630-79045652 CTTTGGAATGAGAAGGTACTTGG + Intergenic
1057205068 9:93166926-93166948 CTGTGGGATGGGAAGGTACAGGG - Intergenic
1058880076 9:109278212-109278234 CTGAGAAATGAGAAGGAACCCGG + Intronic
1059740139 9:117142050-117142072 ATCTGAAACGAGAAGGAGCACGG + Intronic
1060673861 9:125494695-125494717 CTTTGAGATGAGAAGGAGCTTGG - Intronic
1061316564 9:129799911-129799933 AGGGGAAATGAGAAGGAGCATGG - Intergenic
1062688210 9:137827314-137827336 CTGAGAAGTGAGAGGGTGCAGGG - Intronic
1186173082 X:6898116-6898138 CAGTGAGATGTGAAGGTGAAAGG + Intergenic
1186434297 X:9529697-9529719 CTGTGGAATGCCAAGGTGGAAGG + Intronic
1186799979 X:13083194-13083216 CTGTGAAATGGGAAAGAGGAAGG - Intergenic
1187444558 X:19349748-19349770 CTGTGCAATGAGATGGGGCTTGG - Intronic
1187856260 X:23638462-23638484 CTGTGATCTGAGAAGGTACTTGG - Intergenic
1188582482 X:31731401-31731423 CTGTGACATGGGAAGCTGAAAGG + Intronic
1188878917 X:35468288-35468310 CTGTGGAGGAAGAAGGTGCAAGG + Intergenic
1188941573 X:36244027-36244049 CTGTGATCTGAGAATGTGCTGGG - Intronic
1189726740 X:43975088-43975110 GGGAGAAATGAGAAGGTGGACGG - Intergenic
1190171003 X:48111627-48111649 CTGTAAATGGAGAAGGAGCAGGG + Intergenic
1190436007 X:50426186-50426208 CTGTAAAATGAGCTGGTACAGGG - Intronic
1191146800 X:57174927-57174949 CTGTGATTTGAGAAGATGCTCGG + Intergenic
1195439096 X:104881784-104881806 TATTGGAATGAGAAGGTGCATGG + Intronic
1195632649 X:107074985-107075007 TTGTGAAATAAGAAAGTGTATGG - Intronic
1199458309 X:148054227-148054249 CTGTGAAATAGGAAGGTGCATGG + Intergenic
1202603549 Y:26618811-26618833 TTGTGAAATGAGACCGTCCAGGG - Intergenic