ID: 905295536

View in Genome Browser
Species Human (GRCh38)
Location 1:36952055-36952077
Sequence ATGCAGAAACAGGGTCAGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 410
Summary {0: 1, 1: 0, 2: 2, 3: 47, 4: 360}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905295532_905295536 -10 Left 905295532 1:36952042-36952064 CCCGGCTTTGCAGATGCAGAAAC 0: 1
1: 0
2: 9
3: 86
4: 761
Right 905295536 1:36952055-36952077 ATGCAGAAACAGGGTCAGCAAGG 0: 1
1: 0
2: 2
3: 47
4: 360
905295524_905295536 25 Left 905295524 1:36952007-36952029 CCACCTCAGCCCACAGACTGTCA 0: 1
1: 0
2: 2
3: 35
4: 353
Right 905295536 1:36952055-36952077 ATGCAGAAACAGGGTCAGCAAGG 0: 1
1: 0
2: 2
3: 47
4: 360
905295531_905295536 -6 Left 905295531 1:36952038-36952060 CCTGCCCGGCTTTGCAGATGCAG 0: 1
1: 0
2: 1
3: 12
4: 165
Right 905295536 1:36952055-36952077 ATGCAGAAACAGGGTCAGCAAGG 0: 1
1: 0
2: 2
3: 47
4: 360
905295529_905295536 15 Left 905295529 1:36952017-36952039 CCACAGACTGTCAGCACAGGGCC 0: 1
1: 0
2: 3
3: 27
4: 245
Right 905295536 1:36952055-36952077 ATGCAGAAACAGGGTCAGCAAGG 0: 1
1: 0
2: 2
3: 47
4: 360
905295525_905295536 22 Left 905295525 1:36952010-36952032 CCTCAGCCCACAGACTGTCAGCA 0: 1
1: 0
2: 4
3: 38
4: 298
Right 905295536 1:36952055-36952077 ATGCAGAAACAGGGTCAGCAAGG 0: 1
1: 0
2: 2
3: 47
4: 360
905295528_905295536 16 Left 905295528 1:36952016-36952038 CCCACAGACTGTCAGCACAGGGC 0: 1
1: 0
2: 1
3: 20
4: 173
Right 905295536 1:36952055-36952077 ATGCAGAAACAGGGTCAGCAAGG 0: 1
1: 0
2: 2
3: 47
4: 360

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905295536 Original CRISPR ATGCAGAAACAGGGTCAGCA AGG Intronic
901416817 1:9122051-9122073 ATGCCAGACCAGGGTCAGCAGGG - Intronic
902741380 1:18440966-18440988 AGGGAGACACAGGGTCAGCCAGG - Intergenic
903610728 1:24610082-24610104 ATCAGGAAACAGGTTCAGCAAGG + Intergenic
903949183 1:26984724-26984746 ATGCAGGAACAGAGTCAGAGAGG + Intergenic
904473590 1:30750748-30750770 ATGAGGAAACAGGCTCAGGAGGG - Intronic
904940091 1:34159623-34159645 ATGAAGAAACAGGTTCAGAGAGG - Intronic
904964223 1:34359218-34359240 ATGCACCTACAGGGTAAGCAAGG - Intergenic
905295536 1:36952055-36952077 ATGCAGAAACAGGGTCAGCAAGG + Intronic
905522889 1:38613920-38613942 AGGCAGAAGCAAGGTCAGTAGGG - Intergenic
905986828 1:42292633-42292655 TTGCAGACAGAGGGACAGCAAGG + Intronic
906188364 1:43879238-43879260 ATGCTGTAACAGGGTGAGGAAGG + Intronic
906791128 1:48659574-48659596 AGTCAGAAACAAGGTCAACAAGG + Intronic
909661016 1:78082150-78082172 ATGTGGAAACAGGCTCAGGAAGG + Intronic
911939986 1:104032886-104032908 ATGCAGAAAAAAAGTCAGAAGGG - Intergenic
915126514 1:153669397-153669419 ATACAGAAACAGTGTAAGCATGG - Intronic
915733504 1:158070392-158070414 ATGCAGAAACAGTGTCTACAAGG + Intronic
916178715 1:162065270-162065292 ATGCAGAAGGAGAGACAGCACGG - Intergenic
917013349 1:170500696-170500718 ATACAGAAACAGGTTCAGAAAGG - Intergenic
917965281 1:180174867-180174889 ATGAAGAAACAGGCTCGGCCAGG + Intronic
918346571 1:183612633-183612655 ACGAAGAAACAGGCTCAGAAAGG + Intergenic
918373063 1:183881158-183881180 ATGCAAATTCAGGTTCAGCATGG - Intronic
920513312 1:206566529-206566551 ATGCAGGAACTGGGTCTGCAGGG + Intronic
920548900 1:206841584-206841606 ATGCAGATTCTGGCTCAGCAGGG + Intronic
920564025 1:206959725-206959747 AAGCATAAACAGGGCCAGCATGG + Exonic
920786417 1:209046451-209046473 TTGCAGAAACAGGCTGGGCACGG - Intergenic
920904105 1:210143643-210143665 TTGGAGAAACTGGGTCGGCAGGG + Intronic
921232057 1:213083110-213083132 ATGCAGAAACATTGTTAGCTTGG + Intronic
921917170 1:220626007-220626029 ATGCAGATTCAACGTCAGCAAGG + Intronic
922231267 1:223688848-223688870 AACCAGCAACAAGGTCAGCAGGG + Intergenic
922545977 1:226457204-226457226 ATGCCAACACAGGTTCAGCATGG - Intergenic
923248265 1:232154858-232154880 CTGCAGAATCAGGTTCAGCAAGG + Intergenic
923407140 1:233673271-233673293 TTGCAGGGACATGGTCAGCAGGG - Intergenic
1063222768 10:3986104-3986126 AAGCAGAAACAGGGGAAGCCTGG + Intergenic
1063278401 10:4597188-4597210 ATGCAGGAGCAGGGTGAGGAGGG - Intergenic
1063285114 10:4678642-4678664 GTGCAGACACAGTGTCATCATGG + Intergenic
1064816387 10:19269567-19269589 ATCCAGAAACATGGTCAGGCCGG - Intronic
1065155267 10:22863001-22863023 ATGAGGAAACAGGGTCAGAGGGG + Intergenic
1065179608 10:23111538-23111560 ATGCAGAAACCGGAACATCAAGG - Intronic
1065675822 10:28173148-28173170 AAGGAGAACCAGGGTGAGCAGGG + Intronic
1066428556 10:35331490-35331512 ATGATGAAACAGGGACAGCCAGG - Intronic
1067692575 10:48511383-48511405 GTGCAGAATCAGGGGCAGCGTGG - Intronic
1067730620 10:48808596-48808618 ATGCATATACAGGTTGAGCAAGG - Intronic
1070403852 10:76077143-76077165 ATGCAGCACCAGGGCCAGGAAGG + Intronic
1070648601 10:78219059-78219081 AGGCAGAAACAAAGGCAGCAAGG - Intergenic
1070828818 10:79406441-79406463 GTGAAGAAGCAGGGTCAGCAGGG - Intronic
1070990581 10:80728696-80728718 ATGCACAAGCAGGATCTGCATGG - Intergenic
1071162985 10:82772993-82773015 ATACGGAAACAGGCTCTGCAGGG - Intronic
1071164398 10:82787636-82787658 TTGCAGAAGCAGCCTCAGCATGG - Intronic
1071568480 10:86683786-86683808 GGTCAGCAACAGGGTCAGCAAGG + Intronic
1072798879 10:98377964-98377986 ATGAAGAAAGAGGGTAAGGAAGG - Intergenic
1073140950 10:101247321-101247343 ATACAGAACCAGGGTAAGAAGGG + Intergenic
1073324524 10:102634639-102634661 TTCCAGAAACAGCGTCAGCCTGG - Intergenic
1073496362 10:103894872-103894894 ATCCAGAAACATGATAAGCAGGG - Intronic
1073793857 10:106966704-106966726 GTGGAGAAACAGAGTCAGGAGGG - Intronic
1074507012 10:114080000-114080022 GTGCAGAAACAGGGTCAGTTTGG - Intergenic
1075259365 10:120949445-120949467 CTGCAGACACAGGGTGTGCAAGG - Intergenic
1078608189 11:12796076-12796098 GTGCAGAAACTGGGCCAGGAGGG + Intronic
1079075573 11:17383583-17383605 ATGAGGACACAGGGTCAGAAAGG - Intergenic
1080310889 11:30890379-30890401 AAGCAGAAAAATGGTTAGCAAGG - Intronic
1081518320 11:43856027-43856049 ATGCAGAAACAAAGGCAGCTGGG - Exonic
1082806496 11:57454984-57455006 ATGGAGAAACAGGCTCAGAGAGG - Intergenic
1082997358 11:59264572-59264594 ATGAAGAAACAGGCTCAGGTGGG - Intergenic
1083399086 11:62411553-62411575 CTGCAGAAACAGGGAAAGCCAGG + Intronic
1084079962 11:66815901-66815923 ATAGAGAAACAGGTTCAGGAGGG + Intronic
1084112389 11:67022698-67022720 ATGAAGAAACAGGCTCAGAGAGG - Intronic
1084936271 11:72588524-72588546 ATGCAAAAACAGGGATGGCAAGG + Intronic
1085520117 11:77132816-77132838 ATGATGAAACAGGCTCAGGAAGG + Intronic
1086070853 11:82797410-82797432 ATGGAGGACCAAGGTCAGCAAGG + Intergenic
1086527206 11:87741592-87741614 CTGTAGAAACAGGGTCAAGAGGG - Intergenic
1087535016 11:99431907-99431929 AAGCAGAAACAGGGGCTGGAGGG + Intronic
1089854743 11:121533301-121533323 ATGAGAAAACAGGCTCAGCAAGG + Intronic
1090097579 11:123758028-123758050 AGGCAGCAACAGTGTCTGCAGGG + Intergenic
1090132289 11:124157285-124157307 ATTGAGAAACAGTATCAGCAAGG - Intergenic
1091538316 12:1434811-1434833 ATGACGAAAGAGGCTCAGCATGG - Intronic
1091920640 12:4302107-4302129 ATACAGAAGCAGTGTGAGCAGGG + Exonic
1092131674 12:6117423-6117445 ATGCAGAGACAGGGGCTGCTGGG - Intronic
1092523989 12:9298446-9298468 ATGCACAAACTGGGCCAGCTGGG - Intergenic
1092543281 12:9433368-9433390 ATGCACAAACTGGGCCAGCTGGG + Intergenic
1094483984 12:30909392-30909414 GTGCAAAACCAGGGTGAGCAGGG - Intergenic
1094509742 12:31089069-31089091 ATGCACAAACTGGGCCAGCTGGG - Exonic
1095327258 12:40910586-40910608 TTGCAGAAATAAAGTCAGCATGG + Intronic
1096194198 12:49638770-49638792 ATGAGGAAACAGGGTCAGAAAGG - Exonic
1096828409 12:54296550-54296572 ATGAAGATACAGGGGCAGGAGGG - Intronic
1097703469 12:62844229-62844251 AGGCAGAAACAGTTTTAGCAGGG + Intronic
1098655621 12:73026032-73026054 AAACGGAAACAGGCTCAGCAAGG - Intergenic
1099660068 12:85546268-85546290 ATGAAGAAAGATTGTCAGCATGG + Intergenic
1099664768 12:85613877-85613899 ATGGAGGAACAGTGTCACCATGG - Intergenic
1099821675 12:87719329-87719351 ATGAAGAAACAGACTCAGAAAGG - Intergenic
1099873444 12:88375998-88376020 ATGCAGAAGCTGGGTGAGCGTGG - Intergenic
1100467486 12:94859712-94859734 AGGAAGAAAGAGGGTCAGGAAGG - Intergenic
1101101437 12:101397795-101397817 TTAAAGAGACAGGGTCAGCAGGG - Intronic
1101109080 12:101468191-101468213 ATGAAGAAACAGGCTCAGGGAGG - Intergenic
1101322923 12:103689132-103689154 CTGCAGGAACAGTTTCAGCATGG - Intronic
1101625810 12:106440174-106440196 ATAGAGAAAAAGGGTCAGGACGG - Intronic
1101775033 12:107785924-107785946 ATTCAGAAACAGGCCAAGCATGG - Intergenic
1101823235 12:108200308-108200330 ATGAAGAAACAGGCTCAGAGAGG + Intronic
1101846668 12:108368358-108368380 ATGGAGAAACAGGCCCAGAAGGG + Intergenic
1102746865 12:115256610-115256632 ATGCAAAAACAGGTTGAGCAGGG + Intergenic
1103145178 12:118589453-118589475 ATGCAGAAATATGGTAAACAGGG + Intergenic
1103402986 12:120655758-120655780 ATGAAGAGACAGGGGCAGCGGGG - Intronic
1103627841 12:122234241-122234263 ATGCAAAAGCAGGGCCATCAGGG - Intronic
1103753131 12:123181015-123181037 ATACTGAAACAGGATAAGCAAGG + Intronic
1104082739 12:125445315-125445337 ATGAAGAGACTGGGGCAGCAAGG - Intronic
1104509770 12:129366725-129366747 ATGCAAAGACAGGGCCAGCATGG + Intronic
1105260432 13:18775247-18775269 ATGTAGAAGCAGGTTCAGAAGGG - Intergenic
1105262637 13:18791101-18791123 ATGTAGAAGCAGGTTCAGAAGGG - Intergenic
1105893603 13:24699645-24699667 ATGCAGACAAAGTGTCAGGAAGG + Intronic
1106444115 13:29809195-29809217 AAGAAGTAACAGGGTCAACAGGG + Intronic
1107677161 13:42809355-42809377 AAGCAGAACCAGTGACAGCAGGG - Intergenic
1110568275 13:76977920-76977942 ATGCAGATACAGGCTGGGCATGG + Intergenic
1111405292 13:87796371-87796393 ATCCAAAATCAGGGTTAGCAGGG + Intergenic
1112461594 13:99607633-99607655 ATGAAAAAACAGGGTCAGAAAGG + Intronic
1113517267 13:110913612-110913634 ATGTAGCACCAGGGGCAGCAAGG + Intronic
1113539349 13:111094085-111094107 ATGCAGAAAAAGGGTATGGAAGG + Intergenic
1113640398 13:111953067-111953089 ATCCAGCAACAGGGAGAGCAAGG + Intergenic
1114370340 14:22079753-22079775 CTGCAGAAACAGAGTCACTAGGG - Intergenic
1114452141 14:22834339-22834361 ATCCAGAGACAGGGTGAGGAAGG - Exonic
1115086022 14:29515759-29515781 ATGCAGAGAAAGGGGCACCAAGG - Intergenic
1117392835 14:55278975-55278997 ATAAAGAAACAGGGTGGGCATGG - Intronic
1117394043 14:55291218-55291240 ATACAAAAACTGTGTCAGCAAGG - Intronic
1119473602 14:74914069-74914091 ATGGAGAAACAGGCTCAGGAGGG - Intronic
1119859913 14:77928748-77928770 ATGCAAAAACAGGCTGGGCACGG - Intronic
1120678056 14:87445335-87445357 TTGCAGAAATAGAGTTAGCAGGG - Intergenic
1121133012 14:91466400-91466422 ACCCAGAAACCGTGTCAGCATGG - Intronic
1121171097 14:91855084-91855106 ATGAAGAAACAAGTTGAGCAGGG + Intronic
1121889999 14:97581080-97581102 ATTCAGCACCAGGGACAGCAGGG + Intergenic
1122045205 14:99018009-99018031 ATGAGGAAACAGGCTCAGCAAGG - Intergenic
1123479012 15:20613986-20614008 GTGCAGAGGCAGGGGCAGCACGG + Intergenic
1123506089 15:20942031-20942053 TTGCAGCAACAGGGTCTCCAAGG + Intergenic
1123563319 15:21515738-21515760 TTGCAGCAACAGGGTCTCCAAGG + Intergenic
1123599570 15:21953021-21953043 TTGCAGCAACAGGGTCTCCAAGG + Intergenic
1123639000 15:22386399-22386421 GTGCAGAGGCAGGGGCAGCACGG - Intergenic
1125060451 15:35415195-35415217 ATGAATATACAAGGTCAGCATGG + Intronic
1126407619 15:48337433-48337455 ATGAGGAAACAGGCTCAGAAAGG - Intronic
1126922022 15:53537540-53537562 ATGAAGAAACAGAGACAGAAAGG - Intronic
1127764149 15:62168300-62168322 ATGCAGAAACAGGCTCACAAAGG + Intergenic
1128576879 15:68782360-68782382 ATGAAGAAATAGGCTCAGAAAGG + Intronic
1128907211 15:71477792-71477814 AAGGAGAAGCAGGTTCAGCATGG - Intronic
1129335929 15:74852228-74852250 AAACAGAAACAGTGTCAGCCTGG + Intronic
1129676309 15:77633816-77633838 ATACAGAAACTAGGCCAGCAGGG + Intronic
1131245731 15:90791132-90791154 ATGCAGAAATAGGGTCTGAAAGG - Intronic
1132223023 15:100118926-100118948 ATTTGGAAACAGGGTCAACAGGG + Intronic
1202971673 15_KI270727v1_random:242872-242894 TTGCAGCAACAGGGTCTCCAAGG + Intergenic
1132558037 16:581035-581057 CTGCAGAAGCAAGGACAGCATGG + Intronic
1132939526 16:2499959-2499981 ATGCAGCTACAGGGTCTGCGTGG - Intronic
1133361219 16:5175297-5175319 CTGCCAAAACAGGGACAGCACGG - Intergenic
1135323861 16:21513645-21513667 AGCCAGAAACAGGCTCGGCAGGG + Intergenic
1136063452 16:27742614-27742636 AGGAGGAAACAGGCTCAGCAGGG - Intronic
1136392953 16:29976923-29976945 ATAAAGAAACAGGCTCAGCAAGG - Intronic
1138488403 16:57361483-57361505 ATGGAGAAACAGGCTTAGCAAGG + Intronic
1139278569 16:65750267-65750289 ATGAGGAAACAGGCCCAGCAAGG + Intergenic
1139528379 16:67529838-67529860 ATGCAGAAACAGGCCCAGAGAGG + Exonic
1142134767 16:88446604-88446626 ATGCAGCAACAGGGTCTTCCTGG + Intergenic
1143295053 17:5864799-5864821 GTGCAGATACAGGATCAGCATGG - Intronic
1143367435 17:6417323-6417345 ATGGAGAAAGAGGCTGAGCAAGG + Intronic
1143554800 17:7653345-7653367 AGGAGGAAACAGGGTCAGCAGGG - Intronic
1143658914 17:8312942-8312964 TGGCAGACACAGGGGCAGCAGGG - Exonic
1143764050 17:9126046-9126068 TTGCAGAAGCAGAGTCAGGATGG + Intronic
1144449391 17:15363669-15363691 AGGCAGGAACAGGAGCAGCAGGG - Intergenic
1144822078 17:18082292-18082314 ATGTAGAAACAGGCTCAGAGAGG + Intergenic
1146287168 17:31581796-31581818 ATGAGGCAACAGGCTCAGCAGGG - Intergenic
1146374404 17:32284623-32284645 AGACAGCAGCAGGGTCAGCAGGG - Intronic
1147406339 17:40215082-40215104 ATGAAGAAACAGACACAGCAAGG - Intergenic
1150966353 17:69973571-69973593 TTGCAGAGACAGGGGCATCAAGG - Intergenic
1151379475 17:73715522-73715544 ATGCAAAAACAAGATCAGAAAGG + Intergenic
1152057556 17:78042387-78042409 ATGAAGAAACAGGCTCAGAGAGG - Intronic
1152218381 17:79047580-79047602 ATGGCAAAACAGGCTCAGCAGGG + Exonic
1152622211 17:81370677-81370699 ATCTAGAAATAGGGTCAGCCGGG + Intergenic
1154233513 18:12580746-12580768 ATGCAGAAACACTGTCTTCAAGG + Intronic
1154425587 18:14269548-14269570 ATGTAGAAGCAGGTTCAGAAGGG + Intergenic
1154428321 18:14289133-14289155 ATGTAGAAGCAGGTTCAGAAGGG + Intergenic
1154428803 18:14292607-14292629 ATGTAGAAGCAGGTTCAGAAGGG + Intergenic
1154431083 18:14308952-14308974 ATGTAGAAGCAGGTTCAGAAGGG + Intergenic
1154433279 18:14324789-14324811 ATGTAGAAGCAGGTTCAGAAGGG + Intergenic
1154433753 18:14328261-14328283 ATGTAGAAGCAGGTTCAGAAGGG + Intergenic
1156996504 18:43474861-43474883 ATGCAGCAACAAGTTCACCACGG - Intergenic
1157618606 18:49002438-49002460 CAGCAGAAACAGAGGCAGCAGGG - Intergenic
1157655262 18:49380746-49380768 ATGAAGAGACAGGCTCAGAAAGG + Intronic
1159702537 18:71647090-71647112 AAGAAGGACCAGGGTCAGCAAGG - Intergenic
1162531590 19:11239352-11239374 ATGGAGAAACAGGCTCAGCATGG + Intronic
1162796914 19:13091854-13091876 CAGCGGAAACAGGGTTAGCAGGG - Intronic
1163472312 19:17504788-17504810 AGGCAGACACAGGGGCACCAAGG - Exonic
1166072380 19:40394767-40394789 AGGCAGAGACAGGGTCACCTGGG + Exonic
1166799112 19:45444855-45444877 ATACAGAAACAGAGTCAGAGAGG - Intronic
1166950994 19:46428012-46428034 CTGCAGAAAGAGGTTCAGCTTGG + Intergenic
1168233359 19:55047030-55047052 ATGAAGAAACAGGCTCAGAGGGG + Intronic
1168292643 19:55364053-55364075 ATGGAGAAACAGGTTCAGTAAGG - Intergenic
926240400 2:11080869-11080891 AGGCAGAAACAGGGCCAGGCCGG + Intergenic
926412072 2:12614955-12614977 TAGCTGAAACAGGGACAGCATGG - Intergenic
926976450 2:18521085-18521107 AAGCAGACACTGGGTCCGCAGGG - Intergenic
927010279 2:18896990-18897012 ATGCAAACAGAGGGGCAGCATGG - Intergenic
927954547 2:27199438-27199460 CTGCAGACACAGGGACAGCAGGG + Intergenic
930406379 2:50961773-50961795 ATGTTGAATCAGGGTCAACAAGG + Intronic
931173227 2:59827110-59827132 ATGAGGAAACAGGTTCAGAAAGG + Intergenic
931328148 2:61249712-61249734 ATGCAGAAGAAGAGTCTGCAGGG + Intronic
932126826 2:69152194-69152216 GAGCAGGAACAGGATCAGCAGGG - Exonic
932498313 2:72158619-72158641 ACGCAGAAACAGGGACAGGAAGG - Intergenic
935331461 2:101980459-101980481 TGGCAGGAACAAGGTCAGCACGG + Intergenic
937086614 2:119176011-119176033 ATGGAGAATTAGGGCCAGCATGG - Intergenic
937642698 2:124231362-124231384 ATGGAGAAACAGAGTCAGAGAGG + Intronic
937763727 2:125635117-125635139 ATGCAGAAACAGGGATAGCCAGG - Intergenic
938028580 2:127972188-127972210 GTGCAGAAATAGGGTGAGCAGGG - Intronic
938133040 2:128733553-128733575 ATGCAAAGACAGAGCCAGCAGGG + Intergenic
939378859 2:141407999-141408021 ATCCAGAAAGAGGCTCAGCCTGG + Intronic
940858481 2:158748693-158748715 ATGCAGAAAAAAGGTCAACAAGG - Intergenic
941530845 2:166668889-166668911 ATGAGGAAACAGGTTCAGAAAGG + Intergenic
941635410 2:167930492-167930514 ATACAGAAACAGGGCCAGGAAGG + Intergenic
943507554 2:188780546-188780568 ATGCAGAGACTGGGTCAGTCTGG + Intronic
944273844 2:197813066-197813088 AGTCAGAGACATGGTCAGCAGGG + Intronic
945103977 2:206290709-206290731 ATTAATAAACAAGGTCAGCAAGG - Intronic
945464473 2:210151645-210151667 AAGAAGAAACAGACTCAGCATGG - Intronic
946245406 2:218384433-218384455 TTGGAGAAACATGGCCAGCAGGG - Intronic
946310171 2:218878934-218878956 CTGCAGAAACGGGGACAGCTTGG - Intergenic
947768409 2:232652035-232652057 ATGGAGAAACAGGCCCACCAAGG - Intronic
947835739 2:233173971-233173993 AGGCTGAAACAGGCTCAGGATGG + Intronic
947897220 2:233686860-233686882 ATGCAGAAAAAGTGACAGAAAGG - Intronic
948880891 2:240856616-240856638 ATGCAGCAGCAGGCTCAGCATGG + Intergenic
1168749676 20:273583-273605 ATGCAGAATCAGGCTGGGCATGG + Intronic
1170498540 20:16950868-16950890 ATGCAGAAACACTGCCAACATGG + Intergenic
1171400637 20:24871225-24871247 ATGCAGGGACAGGCTGAGCATGG + Intergenic
1172306516 20:33884620-33884642 AGGCAGGGACGGGGTCAGCAGGG - Intergenic
1172963148 20:38812916-38812938 ATGCAGAAACTGACTCAGTAGGG + Intronic
1173613861 20:44390215-44390237 ATGGAGAAACACGCTCAGAAAGG + Intronic
1173943281 20:46930375-46930397 ATGAGGAAACAGGCTCAGAAAGG + Intronic
1174145994 20:48453043-48453065 ACGCAGAAACAGGCCCAGAAAGG + Intergenic
1174307280 20:49622649-49622671 ATGAGGAAACATGCTCAGCAAGG - Intergenic
1174396668 20:50251030-50251052 ATGCAGAAAAGGGGCCAGGATGG - Intergenic
1174466371 20:50720742-50720764 ATGAAGAAACTGAGTCAGGAAGG + Intergenic
1175253202 20:57622161-57622183 ATGCATAAATGGGGTCTGCAAGG - Intergenic
1175357136 20:58377203-58377225 ATGAAGATTCAGGGTCACCAAGG - Intergenic
1176843280 21:13857483-13857505 ATGTAGAAGCAGGTTCAGAAGGG - Intergenic
1176843768 21:13860968-13860990 ATGTAGAAGCAGGTTCAGAAGGG - Intergenic
1176846444 21:13880288-13880310 ATGTAGAAGCAGGTTCAGAAGGG - Intergenic
1176848699 21:13896360-13896382 ATGTAGAAGCAGGTTCAGAAGGG - Intergenic
1176907937 21:14526409-14526431 GTACAGAACCAGGGTCAGCTGGG + Intronic
1178423632 21:32461461-32461483 ATGCAGAAAAAGAGGCAGGAAGG - Intronic
1180569120 22:16699375-16699397 ATGCTGAAACAGGGACTGTAGGG - Intergenic
1181783701 22:25210469-25210491 ATGAAGAAACAGGCTCAGGGAGG + Intergenic
1182078496 22:27511733-27511755 ATGGAGAAACAGGTTCAGGGAGG - Intergenic
1182438145 22:30344499-30344521 AAGCAGAAACAGGCTCAGAAAGG - Intronic
1182483653 22:30626437-30626459 CTGCAGAAACAGATTGAGCAAGG - Intronic
1183321628 22:37168521-37168543 ATGCAGAAACAGGCTCAGAGAGG - Intronic
1183513761 22:38251186-38251208 GTGCAGAAACGTGGCCAGCATGG - Intronic
1183902522 22:41017269-41017291 ATGCAGAAGCAGGCTGGGCACGG - Intergenic
1184064602 22:42110518-42110540 TTGAAGAAACAGAGTCAGGAAGG - Intergenic
1184095470 22:42314081-42314103 AGGCAGATACAGGCTCAGCAGGG + Intronic
1184739066 22:46416584-46416606 AGGCGGAAACAGAGCCAGCAAGG + Intronic
950170532 3:10835824-10835846 AAGCAGAAACAGGGTTGGGAGGG + Intronic
950458591 3:13107481-13107503 ATGGAGAAACAGGCTCAGAGCGG + Intergenic
950570734 3:13798501-13798523 ATGCAGAAAGGGGGTCCCCATGG + Intergenic
951051159 3:18095710-18095732 ATGAAGAAACAGGCACAGAAAGG - Intronic
951429415 3:22588810-22588832 ATGGAAACCCAGGGTCAGCATGG + Intergenic
951619125 3:24581680-24581702 ATCCAGCAACAAGGACAGCAAGG - Intergenic
952474552 3:33694122-33694144 ATGCACAAACAAGTTCAGCTAGG + Intronic
953957646 3:47244145-47244167 ATGCAGAAACAGGCACAGAGCGG + Intronic
954293810 3:49663229-49663251 ATGCCGAAGAAGGGTCAGCCTGG + Exonic
954460973 3:50626746-50626768 ATGCAGAGACAGGTTCAGAAAGG + Intronic
954649031 3:52148925-52148947 AAGCACAAACTGGGTCAACAGGG - Intronic
954792351 3:53142776-53142798 ATGGGGAAACAGGCTCTGCAGGG - Intergenic
955008477 3:54991765-54991787 ATGAAGAAACAGGCTCAGAGAGG - Intronic
956647436 3:71470230-71470252 ATGAAGAAACAGGCTCAGGAAGG - Intronic
958880831 3:99667052-99667074 ATGAAGAAACAGATTCAGGAAGG + Intronic
960988699 3:123296602-123296624 GTCCAGAGACAGGGTCAGCATGG - Intronic
961114430 3:124316558-124316580 CTGCAGAAAGAGGAGCAGCAGGG - Intronic
963973869 3:151459523-151459545 ATGCCTGCACAGGGTCAGCATGG - Intergenic
964176439 3:153829067-153829089 GTCCAAAAAGAGGGTCAGCAAGG + Intergenic
964961718 3:162436190-162436212 TTGGAGAAACAGGGCCAGGAAGG + Intergenic
965539098 3:169854394-169854416 TTACAGAAAAAGAGTCAGCAGGG - Intronic
966586265 3:181629025-181629047 ATGAAGAAACAGGCTCAGAGAGG - Intergenic
967588945 3:191249070-191249092 ATGCAGAAAAGAGGTCAGAAAGG - Intronic
968351015 3:198051924-198051946 ATGCAGAAGCAAGTTCAGAAGGG - Intergenic
968441406 4:626376-626398 ATGCAGAATCAGGGGCACCCCGG - Intronic
968580370 4:1388344-1388366 ATGAATAAACAAGTTCAGCAAGG - Intergenic
968746984 4:2365255-2365277 AGGCAGCAACCGGGACAGCAGGG + Intronic
969455133 4:7296144-7296166 CCACAGAAACAAGGTCAGCATGG - Intronic
969966699 4:11003864-11003886 ATGGAGAAACAGGCTCAGGGAGG + Intergenic
970138730 4:12956447-12956469 ATGAAGAAACAGGCTCAGCAAGG - Intergenic
970304523 4:14717988-14718010 ATGCAGAAACAGGCTGGGCACGG - Intergenic
971996483 4:33972253-33972275 CTGCAGAAAAAGGGTCAGAAGGG - Intergenic
972163423 4:36253326-36253348 AAGGAGAAACAGGGTGAGGAGGG - Intergenic
972699544 4:41480921-41480943 ATGCAGAAAATGGGTCAGTCCGG - Intronic
972908658 4:43785468-43785490 AAGCAGAAACACTGTCAGCTTGG + Intergenic
975765387 4:77662227-77662249 ATGAAGAAACAGGATTCGCAAGG - Intergenic
975845901 4:78524957-78524979 ATGCAGAAACATGGGAAACAGGG + Intronic
977191996 4:94012540-94012562 ATGAGGACACAGGCTCAGCATGG + Intergenic
977207114 4:94175825-94175847 ACCCAGAAACAGGGTGAGCCTGG - Intergenic
978093186 4:104742838-104742860 GGGCAGAAACAGGATCAGGAAGG - Intergenic
978545269 4:109865184-109865206 ATGAGAAAACAGGCTCAGCAAGG + Intronic
978635546 4:110801181-110801203 CTGCAGAGACATGGTCAGCTGGG + Intergenic
979121088 4:116902670-116902692 ATAAAGAAACAGGTTCAACAAGG + Intergenic
979341017 4:119524299-119524321 ATGAAGAAATTGGGACAGCATGG - Intronic
981053547 4:140336150-140336172 ATGTAGAGACAGGGACACCATGG + Intronic
982164255 4:152600780-152600802 AATCAGAAATAGGGCCAGCAAGG + Intergenic
984081696 4:175255242-175255264 TTGCAGAAACAGGCCCACCAAGG + Intergenic
984737680 4:183126004-183126026 ATGTAGATGCAAGGTCAGCATGG + Intronic
986369605 5:7066930-7066952 ATGGAGAGACAGCGCCAGCAAGG + Intergenic
986492142 5:8304215-8304237 AAGGAGAAACAAGGTTAGCAAGG - Intergenic
986681829 5:10240541-10240563 ATGAGAAAACAGGCTCAGCAAGG - Intronic
987116179 5:14728583-14728605 TTCCAGACAAAGGGTCAGCATGG + Intronic
987172023 5:15269125-15269147 ATGAAGAAACAGGCTAAGCAGGG + Intergenic
987257803 5:16174766-16174788 ATGCAGAGACCAGGTCAGGAAGG + Intronic
987275273 5:16355531-16355553 ATGCAGAAATAGGATGTGCAAGG - Intergenic
987332235 5:16867309-16867331 ATGCAGGAAAATGGTCAGTAGGG - Intronic
987960677 5:24804359-24804381 ATGCAGTTACAGGGCCAGCTAGG + Intergenic
988286795 5:29229134-29229156 ATGCACAAACAGGGCGATCATGG - Intergenic
990705535 5:58524806-58524828 ATGCAGAATAAATGTCAGCAGGG - Intergenic
992313413 5:75527036-75527058 ATGCAGAAACAAAGTCAAAAGGG - Intronic
992510241 5:77425633-77425655 ATGAAGAAATAGGCTCAGCAAGG - Intronic
993189349 5:84661525-84661547 ATGTAGAAACAGGCTCAGAAAGG + Intergenic
995910361 5:117179612-117179634 ATGAAGAAGCAGGGGAAGCAGGG + Intergenic
996685175 5:126271989-126272011 ATGCTGAAACAGGCACAGCCTGG - Intergenic
997474655 5:134135818-134135840 AGCCAGAAACAAGGTCAGGAAGG + Intronic
998423009 5:142004786-142004808 AGTGAGTAACAGGGTCAGCAGGG + Intronic
998582633 5:143395312-143395334 CTGCAGAAATAAGGACAGCATGG + Intronic
999139963 5:149353900-149353922 ATAAAGAAACAGGCTCAGAAGGG - Exonic
999798640 5:155011627-155011649 ATGCAATTACAGAGTCAGCAGGG - Intergenic
1001247118 5:170113090-170113112 ATGCAGAAACTGGGACACCCAGG + Intergenic
1001741022 5:174052725-174052747 GTGCAGAAACAGGCTCAGACAGG + Intronic
1002644636 5:180647136-180647158 ATGCAGGAGCAGGGTCTGCTGGG - Intronic
1002809713 6:615744-615766 AACCAGAAACAGGGTAAGAAAGG + Intronic
1002941630 6:1721873-1721895 TTTCAGAAACAGGATCAGAAAGG + Intronic
1003239965 6:4336010-4336032 AGGGAGAAGGAGGGTCAGCATGG + Intergenic
1003248259 6:4402232-4402254 ATACAGAAACAGGGTCGGCGGGG - Intergenic
1003627222 6:7752943-7752965 ATCAAGAAACTGGGTCAGCCAGG + Intronic
1004292061 6:14376487-14376509 ATCCAGAAACACAGTCAGCCCGG - Intergenic
1004444124 6:15682165-15682187 TTGAAGAAACAGGCTCAGAATGG - Intergenic
1005286302 6:24330729-24330751 ATGGAGAAACAGGATCCACAGGG + Intronic
1007357708 6:41333284-41333306 ATGCAGAAATGGGGAAAGCAGGG - Intergenic
1008652598 6:53578144-53578166 AGGCAGAAACAGAGTTAGCCGGG - Intronic
1008725201 6:54409069-54409091 ATGAAGAAACAGGCTCAACATGG + Intergenic
1010509200 6:76697046-76697068 ATGCAGAAATAGGGTCAGGGAGG + Intergenic
1013538256 6:111083248-111083270 TTTCAGAAGCAGGGTCTGCAGGG + Intergenic
1014340241 6:120196743-120196765 ATGTGAAAACAGGGCCAGCACGG + Intergenic
1015391764 6:132690381-132690403 AGGCAGGAGCAGGGTCTGCAGGG - Intronic
1015774375 6:136798780-136798802 ATGAAGAAACAGGTCCAGAAAGG - Intergenic
1016422133 6:143896562-143896584 ATAAGGAAACAGGTTCAGCAAGG - Intronic
1017040200 6:150302121-150302143 AGGCAGCAACAGGGTCAGCCTGG - Intergenic
1017761296 6:157571999-157572021 ATGCAGATTCTGGCTCAGCAGGG + Intronic
1019668791 7:2267094-2267116 ATGGAGAAACAGGCTCAGGGAGG - Intronic
1019872484 7:3777940-3777962 ATGCTGAGAAAGGATCAGCAGGG + Intronic
1019957244 7:4425085-4425107 ATGTTGAACCAGGGCCAGCATGG + Intergenic
1020363332 7:7353429-7353451 ATGCAGGAAGAGGGGCAGCTAGG - Intergenic
1021974165 7:25995554-25995576 ATACAGAAACAGTCTCACCATGG + Intergenic
1022504328 7:30901036-30901058 AGGCAGAAAGAGGGCCAGGAGGG - Intergenic
1022525791 7:31036347-31036369 ATGAAGAAACAGGCTCAGAAAGG + Intergenic
1024042839 7:45568366-45568388 ATGCAGAAAAGGGGTCATGATGG - Intergenic
1026971820 7:74473173-74473195 ATGCAGAATTGGGGTCAGCCTGG + Intronic
1028340328 7:89711475-89711497 ATGCAGAAACAGGGGCACTGAGG - Intergenic
1029260355 7:99298109-99298131 ATGAGGAAACATGTTCAGCAAGG - Intergenic
1029843202 7:103387588-103387610 ATGCAGAAACAGGCTCTGAGAGG + Intronic
1030160360 7:106502159-106502181 CTGCAGAAGCAGAGTCAGGAGGG - Intergenic
1030856320 7:114562153-114562175 ATGCTGCAGCAGGGTCAGAAAGG - Intronic
1033179742 7:139164320-139164342 ATGAGGAAACAGGCTCAGAAAGG + Intronic
1033551479 7:142451828-142451850 AGGAAGCAACAGGGTCACCAGGG - Intergenic
1034273181 7:149813013-149813035 AAGCAAACACAGGGTCACCACGG + Intergenic
1034788864 7:153949885-153949907 AGGCTGAAACAGGGTCTGGAGGG + Intronic
1035175100 7:157044838-157044860 ATGCAGAAGCAGCGTCTCCAAGG + Intergenic
1035633180 8:1124219-1124241 AGACAGAAACTGAGTCAGCAGGG + Intergenic
1036034481 8:5004165-5004187 TTGCAGAAACATGGTAATCAGGG + Intergenic
1037304375 8:17489920-17489942 AGGTAGACACAAGGTCAGCAGGG + Intergenic
1037567284 8:20128521-20128543 CTGCAGAAACAGTGTAAGCTGGG + Intergenic
1039894711 8:41708601-41708623 ATGAATAAACAGAGTCAGAAAGG - Intronic
1039911380 8:41829412-41829434 ATGCAGAAAGAGGCTCAGAGAGG + Intronic
1040594359 8:48823095-48823117 ATGCTGAACCAGGGTCAGGCAGG + Intergenic
1041148043 8:54899454-54899476 ATCCAGACACAGGGACAGCGAGG + Intergenic
1042535090 8:69850823-69850845 ATTAAGAGACAGGGACAGCAAGG + Intergenic
1042735302 8:71981176-71981198 CTGCAGACAGAGGGCCAGCAAGG + Intronic
1042809521 8:72808802-72808824 ATGCAGATTTAGGGTCAGGAAGG - Intronic
1044406519 8:91833214-91833236 ATGCAGCAAGAAGGCCAGCATGG + Intergenic
1044523320 8:93224386-93224408 ATGGAGGAAGCGGGTCAGCAGGG - Intergenic
1044571985 8:93730232-93730254 CTGCAAAAACAGAGGCAGCAAGG + Exonic
1046517118 8:115276926-115276948 ATAAAGAAACAGGGTAAACAGGG + Intergenic
1046949581 8:120006903-120006925 GTGCAGAAAAATGGGCAGCACGG - Intronic
1048511973 8:135071290-135071312 ATGAAGAAATAGGATCAGAAAGG - Intergenic
1049006998 8:139862119-139862141 ATTCAGAAACAGGTTCTGTAAGG + Intronic
1049048222 8:140169891-140169913 ATGCAGAAACTAGCTGAGCATGG - Intronic
1049799405 8:144510800-144510822 CTGCAGACATAGGCTCAGCAAGG - Exonic
1050023220 9:1306690-1306712 ATGAAGAAGGAGGGTCTGCAGGG + Intergenic
1052236499 9:26217459-26217481 ATGCAGAAGCAGGCACAGGAAGG + Intergenic
1053002522 9:34585195-34585217 AGGCAGGTACAGGGTGAGCAAGG + Intronic
1053405987 9:37876507-37876529 ATTCAGAAACAGTGCCAGGAGGG + Intronic
1053496110 9:38549293-38549315 ATGTAGAAGCAGGTTCAGAAGGG - Intronic
1053665650 9:40315683-40315705 ATGTAGAAGCAGGTTCAGAAGGG + Intronic
1053915233 9:42940730-42940752 ATGTAGAAGCAGGTTCAGAAGGG + Intergenic
1054376806 9:64455713-64455735 ATGTAGAAGCAGGTTCAGAAGGG + Intergenic
1054518964 9:66060601-66060623 ATGTAGAAGCAGGTTCAGAAGGG - Intergenic
1054519394 9:66063548-66063570 ATGCAGGAACAGGTTCAGAAGGG - Intergenic
1056801355 9:89694276-89694298 ATGCAGAAACTGGATGAACAGGG + Intergenic
1057183616 9:93043285-93043307 ATGCAAAAACAGGAACTGCATGG + Intergenic
1057676033 9:97136811-97136833 ATGTAGAAGCAGGTTCAGAAGGG - Intergenic
1058048995 9:100387766-100387788 AAGCAGGAAAAGGGTCAGCCTGG - Intergenic
1058463420 9:105204755-105204777 ATGCAGGAACAGGAGCAGAAAGG - Intergenic
1058478767 9:105369502-105369524 ATGTTGAAACATAGTCAGCAAGG - Intronic
1058479786 9:105380154-105380176 ATGGAAAAACAGGCTCAGAATGG + Intronic
1058665492 9:107310822-107310844 ATGAAGAAACAGGCTTAGAAAGG + Intronic
1059417749 9:114172412-114172434 CTACAAAAACAGGCTCAGCATGG - Intronic
1059672790 9:116507347-116507369 ATGGAGAAACAGGCACAGAAGGG + Intronic
1059757785 9:117309999-117310021 ATGAAGAAACAGGCTCAGAAAGG - Intronic
1061377864 9:130236732-130236754 CTGCAGGAACAGGGACAACAGGG - Exonic
1061787095 9:133036041-133036063 TTGCAGAAGGAGGGTCAGGAAGG - Intronic
1062027961 9:134349272-134349294 GTGCAGAACAGGGGTCAGCAGGG - Intronic
1185920709 X:4088870-4088892 ATTCAGAACCAGAGGCAGCAAGG - Intergenic
1187599764 X:20815056-20815078 AGGCAGAAATAGGGTCAGAAAGG + Intergenic
1187626711 X:21122535-21122557 TTTGAGAAACAGGGTCATCAGGG - Intergenic
1189141905 X:38616003-38616025 ATGCAGAAACAGGCCCAGAGAGG - Intronic
1190736810 X:53260941-53260963 GTGCAGAGCCAGGGGCAGCACGG - Intronic
1194147423 X:90280810-90280832 ATGCAGTAAAAGGGTCAGTGGGG + Intergenic
1195272162 X:103242685-103242707 CTGGAGAAAGAGGGTCAGGAGGG - Intergenic
1195845197 X:109220170-109220192 ATGCAGAATCAGGCTCAACTTGG + Intergenic
1201038136 Y:9803559-9803581 GAGCAGAAACAGGGTCAGATTGG + Intergenic