ID: 905301478

View in Genome Browser
Species Human (GRCh38)
Location 1:36989069-36989091
Sequence CTGTGTTTGTGCAGGGAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 768
Summary {0: 1, 1: 1, 2: 6, 3: 83, 4: 677}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905301478 Original CRISPR CTGTGTTTGTGCAGGGAGGG AGG (reversed) Intronic
900092818 1:927812-927834 CTGTCCTTGGGCAGGGTGGGTGG + Intronic
900152006 1:1182861-1182883 CTGGGTTTCTGCAGAGAGCGCGG - Exonic
900582400 1:3415606-3415628 GTTTGTTTGTGCGGGGAGCGAGG + Intronic
900820254 1:4881076-4881098 ATGAGTGTGTGCAGGGAGTGGGG + Intergenic
901029831 1:6300633-6300655 CTGTGTTTGTGGAGAGAGGCCGG - Intronic
901917445 1:12510845-12510867 CTGTGGGGGTGCAAGGAGGGAGG - Exonic
902177627 1:14662727-14662749 GTGTGTTGGGGAAGGGAGGGAGG + Intronic
903139772 1:21332576-21332598 CTGTGTTAGTCCAGGGGGAGGGG + Intronic
903220383 1:21865925-21865947 CTTGGTTTGGGCAGGGAGGGGGG - Intronic
904032513 1:27542086-27542108 CTGCGTTTGTGCTGGAAGGCTGG - Intronic
904876851 1:33661932-33661954 CTGTGTGTGTGGTGGGAGGGAGG - Intronic
905301478 1:36989069-36989091 CTGTGTTTGTGCAGGGAGGGAGG - Intronic
906063265 1:42962057-42962079 CTGTGTGTGGGCAGGTGGGGTGG - Intergenic
906106977 1:43300617-43300639 GTGTGTTTGTGCCGGGGGGAGGG + Intergenic
906668500 1:47638425-47638447 CTGTGGTGGCCCAGGGAGGGAGG + Intergenic
907247446 1:53117041-53117063 CTGTCTTTGTTCAGAGAAGGGGG + Intronic
907268859 1:53278698-53278720 TTGTGCATGTGCAGGGAGGGTGG + Intronic
907306721 1:53517394-53517416 CGGTGTTTGTGGAGGGAGCCTGG + Intronic
907372636 1:54013324-54013346 CTGTGTTCCTGCAGGGCAGGGGG + Intronic
907751725 1:57269480-57269502 CTGTGAGTGGCCAGGGAGGGGGG - Intronic
907756272 1:57313751-57313773 CTGTGTGTTTGCAGGAAGAGGGG - Intronic
908789387 1:67766756-67766778 CCCCGTTTGTGCAGGAAGGGAGG - Intronic
908802231 1:67892127-67892149 CTGTGTGTGTGCAGGGTCAGGGG - Intergenic
909195507 1:72616828-72616850 CTGTGTGTGTGCGGGGGGGAGGG - Intergenic
909983030 1:82127267-82127289 CTGTCTTTGTGCAAGGAGCTTGG - Intergenic
910114468 1:83716904-83716926 CTGTGGTGGTGAGGGGAGGGTGG - Intergenic
910122984 1:83810783-83810805 GTGTGTATGTGCAGAGATGGGGG - Intergenic
910159628 1:84259314-84259336 CGGTGCCTGTGCAGAGAGGGTGG + Intergenic
910853274 1:91669636-91669658 GTGTGTTTGTGGAGTGAGCGTGG - Intergenic
911935095 1:103960228-103960250 CTGTGCTGGTGGAGGGTGGGAGG + Intergenic
912028152 1:105204987-105205009 AAGAGTTTGTGCAGGGAGTGAGG - Intergenic
912473898 1:109923871-109923893 CTGTGGCTGAGCAGAGAGGGTGG - Exonic
912552595 1:110493972-110493994 CTGAGTGTGTGCTGGGAAGGGGG - Intergenic
912760215 1:112359773-112359795 CTGTATTTGGGCAGAGAGGAGGG - Intergenic
915364386 1:155306259-155306281 GTGTGTTTGTGGCAGGAGGGAGG - Intergenic
915567909 1:156726792-156726814 CAACGTTTGTGGAGGGAGGGAGG - Intronic
915735130 1:158079633-158079655 TTTTGTTTTTGCAAGGAGGGAGG + Intronic
915836206 1:159177586-159177608 GTGTGTTTGTGGTGGCAGGGAGG - Intronic
916178104 1:162059766-162059788 CTGCTTTTGTGGAGGGAAGGTGG - Intergenic
916990576 1:170239640-170239662 CTGTGTATGGGTGGGGAGGGAGG + Intergenic
916990824 1:170242922-170242944 GTGTGTGTGTGTGGGGAGGGGGG + Intergenic
917745605 1:178003825-178003847 CTGTGTTTGTGGAGGGAGTGTGG + Intergenic
917845599 1:179017503-179017525 CTGTGTTTGCGTATGGAGGAAGG + Intergenic
918205046 1:182300708-182300730 GTGTGTTGGTGGAGGGTGGGTGG + Intergenic
919813196 1:201421830-201421852 GTGTGTGTGTGAAGGGTGGGAGG - Intronic
919832519 1:201552145-201552167 CTGTGTTTGGGATGGCAGGGAGG + Intergenic
920176471 1:204104860-204104882 CTGTCGTTGTGGAGGGAGGAAGG + Intronic
920363672 1:205436581-205436603 CTGTGTTTGTGTTGGGAGCAGGG + Intronic
920440694 1:205978737-205978759 CTGTGCTTGGGCAGGCAGTGGGG + Exonic
920749717 1:208662274-208662296 GTGTGTTTGTTGGGGGAGGGGGG - Intergenic
921289202 1:213639464-213639486 CTGGGGTGGAGCAGGGAGGGAGG + Intergenic
922176707 1:223202837-223202859 CTGTGCTTGTGCGTGGGGGGAGG + Intergenic
922343621 1:224677736-224677758 CTGTCTGAGTGCAGGGAGGTGGG - Intronic
922434803 1:225593389-225593411 CTGTGTGTGTGTGGGGGGGGGGG + Intronic
922702431 1:227769698-227769720 CTGTGGTTGTGGAGGGTGGAGGG + Intronic
922920285 1:229296001-229296023 CTTTGTGTGTCCAGGGACGGTGG + Intronic
923154468 1:231265599-231265621 CTGTGTTTGTTCAGGAAGCTTGG + Intronic
924131424 1:240912706-240912728 ATGTGTTTGTGTTGGGAGTGAGG - Intronic
924632273 1:245752309-245752331 CTCTGTGAGGGCAGGGAGGGAGG - Intronic
1062899426 10:1131217-1131239 CTTTGTATGTGCAGTGTGGGAGG - Exonic
1062969847 10:1639042-1639064 AAGTGTTTGTGCAGTCAGGGTGG + Intronic
1062974411 10:1672742-1672764 GTGTGTGCGTGGAGGGAGGGAGG - Intronic
1063205681 10:3828566-3828588 CTGTGTGTGTGCATGGGGTGAGG + Intergenic
1063379690 10:5576648-5576670 CTGTGTGTGTGCAGGGAGTAGGG - Intergenic
1063379858 10:5577544-5577566 GTGTGTGTGTGCAGGGTGTGTGG - Intergenic
1063622913 10:7666003-7666025 GCGTGTTTGTGCACGGTGGGAGG - Intronic
1063943752 10:11157381-11157403 GTGTGTGTGTGGGGGGAGGGCGG - Intronic
1064203867 10:13306374-13306396 ACGTGTGTGTGCAGGGAGGCTGG + Intergenic
1065773482 10:29099144-29099166 GTGTGTGTGTGCAGGTAGGGAGG + Intergenic
1066164522 10:32772235-32772257 AAGAGTTTGTGCAGGGAGTGGGG + Intronic
1067172867 10:43922293-43922315 CCGTGTTTGGGGAGGAAGGGAGG - Intergenic
1067552641 10:47246319-47246341 CTGTGTTTGGGAAGGGAGCTGGG + Intergenic
1067695911 10:48535560-48535582 CTGTCTTACTGCAGGGAGGATGG + Intronic
1067896967 10:50193007-50193029 CTGTATTTGTGTTGGGAGGGAGG - Intronic
1067952004 10:50749026-50749048 CTGTATTTGTGTTGGGAGGGAGG + Intronic
1069244639 10:66188568-66188590 GTGTGTGTGTGGGGGGAGGGGGG + Intronic
1069470354 10:68683236-68683258 TTGTGTTTTTGCTGGGAGGCAGG + Intronic
1069556600 10:69402422-69402444 CTGTGTTTGGGTAGAGAGGGAGG - Intergenic
1069605904 10:69738396-69738418 CTGTGGCTGAGCAGGAAGGGAGG + Intergenic
1069966637 10:72123515-72123537 CTGTGCGTGTGCAGGGATGGGGG + Intronic
1070524821 10:77286755-77286777 GTGTGTGTGTGCGGGGGGGGGGG + Intronic
1071234642 10:83631246-83631268 GTGTGTGTGTGTAGGGTGGGAGG + Intergenic
1071479432 10:86053793-86053815 GTGTGTCTGTGTAGGGATGGGGG - Intronic
1071504676 10:86225492-86225514 GTGTATTTCTGCAGGGAAGGAGG + Intronic
1071509629 10:86253416-86253438 CTGAATGTGTGCAGGGAGTGAGG + Intronic
1071586223 10:86824202-86824224 CTGTGTTTTTGCAAGAAGGTGGG + Intronic
1072111672 10:92327038-92327060 CTGTGTAAGTGTAGGGAGAGAGG - Intronic
1072744248 10:97928791-97928813 TTGAGTTTGCCCAGGGAGGGGGG + Intronic
1072758006 10:98033338-98033360 CTGTGTTTGGGCAATGTGGGAGG - Intergenic
1073853886 10:107653123-107653145 GTGTGTTTGTGCTAGGAGAGGGG + Intergenic
1074921728 10:118021067-118021089 GTGTGTATGTGTAGGCAGGGTGG - Intronic
1075040503 10:119103987-119104009 CTGTGATGGTCCGGGGAGGGAGG + Intergenic
1075427874 10:122355974-122355996 CTGGGGTTGTGCAGGCAGGATGG + Intergenic
1076538184 10:131196355-131196377 CTGTGCATTTGCAGGGAAGGTGG + Intronic
1076652902 10:132002253-132002275 CTCTGTGTGGGCAGGGAGGATGG - Intergenic
1076859460 10:133133753-133133775 CTGTGGTTGTTCAGGGCAGGCGG + Intergenic
1076979715 11:197991-198013 CTATTTTTGAGCAGGGAGAGTGG - Intronic
1077340373 11:2023745-2023767 GTGTGTGGGTGCAGGGAGGTGGG + Intergenic
1077426997 11:2485370-2485392 CTGGTTTTGTCCAGGGTGGGGGG - Intronic
1077549389 11:3193361-3193383 CTGGCGTTGTGCAGGGAAGGGGG - Intergenic
1077618422 11:3696495-3696517 CTGTCTTGGTGCAGGGGGGAGGG + Intronic
1078197309 11:9146696-9146718 TTGTGGGTATGCAGGGAGGGAGG + Intronic
1078350126 11:10586154-10586176 CTGTGTGTGTGTGTGGAGGGTGG + Intronic
1078645223 11:13135906-13135928 CTGTGTTTATGCAGGGAAATGGG - Intergenic
1079130887 11:17746348-17746370 CTGTGGTTGTGGATGGTGGGTGG - Intronic
1080935263 11:36856839-36856861 GTGTGTGTGTGCGGGGGGGGGGG - Intergenic
1081432961 11:42996691-42996713 GTGTGTGTGTGGAGGGCGGGGGG - Intergenic
1081577219 11:44326784-44326806 GCGTGTGTGTGGAGGGAGGGAGG + Intergenic
1081968762 11:47184939-47184961 CTGTGTTTGCTCTGGGAGGCCGG - Intronic
1082982740 11:59138071-59138093 CAGTGTGTGTACAGGGAAGGGGG + Intergenic
1083268041 11:61556030-61556052 GTGTGTGTGTGTGGGGAGGGGGG + Intronic
1083275079 11:61592353-61592375 GTGTGTGTGTGTAGGGAGTGGGG + Intergenic
1083333815 11:61911645-61911667 CTCTGTTTCTGCAGGGAACGGGG - Intronic
1083363485 11:62127748-62127770 CTGTGTTTGGGCAGGGAGTGAGG + Intronic
1083711509 11:64552538-64552560 GTGCATTTTTGCAGGGAGGGAGG - Intergenic
1084035126 11:66504963-66504985 CTGTGTGTGTGTCGGGGGGGTGG - Intronic
1084144353 11:67256201-67256223 GCGTGTGTGTGGAGGGAGGGAGG + Exonic
1084967716 11:72752995-72753017 CTGTGTATGTGCTGGGAGGATGG - Intronic
1085413922 11:76307733-76307755 CTGTGTGTGTGTTGGGAGGTGGG - Intergenic
1085445138 11:76596469-76596491 CTGTTGGGGTGCAGGGAGGGTGG - Intergenic
1086419422 11:86623909-86623931 ATGTGTGTGGGCAGGCAGGGAGG - Intronic
1086490248 11:87352331-87352353 TTGTGTATGTGGAGGGGGGGGGG - Intergenic
1086921307 11:92590399-92590421 CTGTGTTTGGAAAGGGTGGGAGG + Intronic
1087242645 11:95797161-95797183 GTGTGTGTGTGTTGGGAGGGGGG - Intronic
1087771495 11:102215328-102215350 AGGGGTTTTTGCAGGGAGGGTGG - Intronic
1087958225 11:104316145-104316167 CTATGTTTGTGAAGTGAGGTTGG + Intergenic
1088536181 11:110864250-110864272 CTGTATATGTTTAGGGAGGGAGG + Intergenic
1088949504 11:114553043-114553065 CAGTGTTGGTGCAGTGAGGGAGG - Intronic
1089018732 11:115189109-115189131 CAGTGTTCCTGCAGGGAGTGGGG + Intronic
1090358895 11:126159449-126159471 GTGTGTGAGTGCAGGGAGTGGGG + Intergenic
1090359107 11:126160433-126160455 CTGTGTTTGTGCAGGGGTGGAGG + Intergenic
1090798933 11:130159051-130159073 TGGTGTCTGTGCTGGGAGGGAGG + Intergenic
1090909225 11:131104066-131104088 CTGTGTCTGTGCAAGGTGGGTGG - Intergenic
1091028501 11:132162513-132162535 GTGTGTTTGTGGGGGGAGTGTGG + Intronic
1091323882 11:134669882-134669904 CTGTGTGTGCACAGGGAGGGGGG + Intergenic
1202823358 11_KI270721v1_random:78934-78956 GTGTGTGGGTGCAGGGAGGTGGG + Intergenic
1091401414 12:182758-182780 CTCTGAGGGTGCAGGGAGGGAGG - Intergenic
1091706347 12:2695893-2695915 GTGTGTCTGTGTAGTGAGGGGGG - Intronic
1091783006 12:3225671-3225693 CTGTTATTGTGGAGGGCGGGGGG - Intronic
1091903790 12:4166074-4166096 GTGTGTGTGTGCAGGGAAGAGGG - Intergenic
1092182017 12:6452476-6452498 TAGTGTGTGTGGAGGGAGGGTGG + Intronic
1092632246 12:10394657-10394679 CTGTGTCTGTGTAGAAAGGGAGG + Intronic
1093235570 12:16605446-16605468 CTGTGTTTGGGCATGGGGGCGGG - Intronic
1093534142 12:20202670-20202692 AAGGGTTTGTGCAGGGAGTGGGG + Intergenic
1094043383 12:26141263-26141285 CTGTGTTTGGGGATGGAGGAAGG + Intronic
1094344250 12:29449266-29449288 GTGTGTGTGTGTAGGGAGGGGGG - Intronic
1095280758 12:40350061-40350083 CTGGGACTGTGCAGGGAGCGGGG - Intronic
1095779488 12:46043770-46043792 CTGTGTGTGTGTTGCGAGGGTGG + Intergenic
1096255754 12:50061225-50061247 CTGTATTTGTGCAGAAAGGATGG + Intronic
1096491575 12:52015612-52015634 CTGTGTGTGTGGAGGGTGGGGGG - Exonic
1096511511 12:52132238-52132260 CAGTGATTGCACAGGGAGGGGGG + Intergenic
1096689008 12:53307992-53308014 GTTTGTTTGTGCAGGAAGGCTGG + Intronic
1097798817 12:63890706-63890728 CTTTGATTTTGCAGGGATGGGGG - Intronic
1098998490 12:77149331-77149353 GTGTGTGTGTTGAGGGAGGGAGG - Intergenic
1099444264 12:82733475-82733497 TTGTGCATGTGTAGGGAGGGTGG + Intronic
1099631514 12:85152317-85152339 CAGTGTTTGTGAAGGGAAGCGGG - Exonic
1099793721 12:87369054-87369076 GTGTGTATGTGGAGGGCGGGGGG + Intergenic
1100141737 12:91627276-91627298 ATGTGTTGGTGGAGGGCGGGGGG - Intergenic
1101595519 12:106161140-106161162 CTGGGTTTGTCCAAGGATGGTGG + Intergenic
1101820853 12:108183383-108183405 CTGTGTATGTGCTGGGGGTGAGG + Intronic
1102867924 12:116388952-116388974 GTGTGTGTGTGGCGGGAGGGTGG - Intergenic
1102989379 12:117303786-117303808 CTGAGTTTGTGCAGGGAGGATGG + Intronic
1103335839 12:120189038-120189060 CAGAAGTTGTGCAGGGAGGGGGG + Intronic
1103444325 12:120984264-120984286 ATGTATTTGTGCAGGGTGGCTGG + Intronic
1104581111 12:130011453-130011475 CTGAGTGTGTGCACGGAGGGTGG - Intergenic
1104759688 12:131289479-131289501 CTGAGGCTGTGCAGGGAGGAGGG - Intergenic
1105804387 13:23943103-23943125 CTCAGCTTGTGCAGGCAGGGAGG + Intergenic
1106856605 13:33860377-33860399 ATGTGTTTGTGCAGTCATGGAGG - Intronic
1106940502 13:34773115-34773137 CTGTGTTTGTTCAGGAATAGTGG + Intergenic
1106994594 13:35466996-35467018 TTGTGTATGTGCATGGAGGGGGG - Intronic
1107134483 13:36928951-36928973 GTGTGTGTGTGTAGTGAGGGTGG + Intergenic
1108632892 13:52303339-52303361 CTGTGTTTGTGATGGCAGTGGGG + Intergenic
1108637305 13:52348357-52348379 CTGTGTTTCTGCAGGGATGAAGG - Intergenic
1108653805 13:52509258-52509280 CTGTGTTTGTGATGGCAGTGGGG - Intergenic
1108945685 13:56019851-56019873 CTGAGTTTGGGCAGGCAGTGGGG + Intergenic
1110195461 13:72782908-72782930 TTGTGTTTGTGTTGGGGGGGCGG + Intronic
1111262957 13:85766750-85766772 CTGAGTTTGGGTAGGGAGGGAGG + Intergenic
1111658879 13:91184539-91184561 CTGTGTTGTGGCAGGGATGGAGG + Intergenic
1111794554 13:92901467-92901489 CTGTGTTTGTGGCGGGTTGGGGG - Intergenic
1111908503 13:94283561-94283583 CTGTGTTAGTACAGGGTTGGTGG - Intronic
1111928232 13:94485523-94485545 CTGTGTTTGTGCAAGGTTGATGG - Intergenic
1112317985 13:98381641-98381663 CTGCGTTTGTGCAGGTCGTGTGG + Intronic
1112577820 13:100652666-100652688 CTGTGTTTATGCAGAGTGGGAGG - Intronic
1112726494 13:102310685-102310707 CTGTGTGTGTGTGGGGGGGGGGG + Intronic
1113106102 13:106772851-106772873 GTGTGTGTGTGGAGGGAGAGGGG - Intergenic
1113343668 13:109451949-109451971 CTGTGCATGTGTAGGTAGGGTGG - Intergenic
1113666498 13:112145250-112145272 CTGTCATTATGCTGGGAGGGAGG - Intergenic
1113743442 13:112726278-112726300 CAGTCTGTGTGCAGGGAGAGGGG + Intronic
1113777944 13:112959486-112959508 CTTTGTTCCTGCAGTGAGGGAGG + Intronic
1113985855 13:114314828-114314850 GCGTCTTTGTGCAGGGAGCGGGG + Intronic
1114066736 14:19066334-19066356 CTGTGTTTGAACAGGTAGGTTGG + Intergenic
1114095530 14:19333693-19333715 CTGTGTTTGAACAGGTAGGTTGG - Intergenic
1114131061 14:19793218-19793240 ATGTGTTTTTGCTGGTAGGGTGG + Intronic
1117575367 14:57092142-57092164 CTGTGTTTTTACAGAGTGGGAGG + Intergenic
1117596638 14:57332565-57332587 CTGTGTGTGTGCAAGGTGTGGGG + Intergenic
1117982043 14:61351241-61351263 CTGTCTTTGTGAGGGGATGGAGG + Intronic
1118177126 14:63451806-63451828 CTGTGCTTGTGCAGGGACAGGGG + Intronic
1118568694 14:67171649-67171671 CTGTGTTTGTGAGGGGGGGATGG - Intronic
1118866103 14:69704845-69704867 CTGTGTGTGTCCAGGGAGTGGGG + Intronic
1119170278 14:72529651-72529673 CTGTGGGATTGCAGGGAGGGGGG - Intronic
1119441233 14:74630192-74630214 GTGAGTATGTGCAGGGAGTGAGG + Intergenic
1119768654 14:77206390-77206412 CTGGGGTGGAGCAGGGAGGGAGG + Intronic
1120361919 14:83514903-83514925 CTGTGATTTTGCAGGGAGGGAGG + Intergenic
1120982847 14:90306329-90306351 CTGTGTTTGGTCAGTGAGGAGGG - Intronic
1121077948 14:91084889-91084911 TTGTGTTTATCAAGGGAGGGTGG + Intronic
1121302168 14:92880624-92880646 CAGTGATTGTGCAGGGAGCTGGG - Intergenic
1121894507 14:97634010-97634032 AGGTATTTGTGGAGGGAGGGAGG + Intergenic
1122238794 14:100348251-100348273 ATGTCTTTGTGCAGGTGGGGTGG + Intronic
1122891728 14:104735142-104735164 CTGTGTGTGAGCAGGAAAGGGGG + Intronic
1123574119 15:21648839-21648861 ATGTGTTTTTGCTGGTAGGGTGG + Intergenic
1123610735 15:22091424-22091446 ATGTGTTTTTGCTGGTAGGGTGG + Intergenic
1123629882 15:22254242-22254264 CTGTGGTTGTGCAGGGTTGAAGG - Intergenic
1124685104 15:31776095-31776117 CCGTCATTGTGCAGGGAGAGGGG + Intronic
1125491896 15:40154794-40154816 CTGTGTTTCTCAAGGGTGGGAGG + Intergenic
1126731086 15:51683779-51683801 CCTTTTTTGTGCAGGGTGGGAGG - Intronic
1127304140 15:57685502-57685524 CTGTGTGTGTCGGGGGAGGGTGG + Intronic
1127340965 15:58043716-58043738 CCGTTTTTTGGCAGGGAGGGAGG - Intronic
1127803890 15:62500918-62500940 CTGTGTTGCTGCAGGGACTGTGG - Intronic
1128041443 15:64577985-64578007 CTGTTTTCTTGCAGGGAAGGGGG - Intronic
1128349190 15:66877778-66877800 CTGTGCTGGGACAGGGAGGGTGG + Intergenic
1128707266 15:69845711-69845733 CTGTGTATGTGTGGGGAGGGAGG + Intergenic
1128859634 15:71055842-71055864 CTGTGTGTGTGTGGGGGGGGGGG + Intergenic
1128927203 15:71668538-71668560 GTGTGTGTGTGCTGGGAGTGGGG - Intronic
1129035539 15:72646473-72646495 CTGTGTCTGGGCAGGGAGTGGGG - Intergenic
1129214345 15:74090743-74090765 CTGTGTCTGGGCAGGGAGTGGGG + Intergenic
1129391063 15:75221182-75221204 CTGTGTCTGGGCAGGGAGTGGGG - Intergenic
1129473244 15:75766687-75766709 CTGTGTCTGGGCAGGGAGTGGGG + Intergenic
1129731487 15:77935093-77935115 CTGTGTCTGGGCAGGGAGTGGGG + Intergenic
1129762025 15:78134744-78134766 GTGTGTGTTTGCTGGGAGGGAGG + Intronic
1130079702 15:80721839-80721861 CTTTGTTTCTGGAGGGAAGGAGG + Intronic
1131056867 15:89380018-89380040 CTGTGTATGTGCAGAGAGACAGG - Intergenic
1131107805 15:89746650-89746672 GTGTGTTTGTGTGGGGAGGTAGG - Intergenic
1131446462 15:92502041-92502063 CTGAGGTTCTGCAGGGAGGAGGG - Intergenic
1131462166 15:92625149-92625171 CAGAGTTTGGGGAGGGAGGGAGG - Intronic
1202982983 15_KI270727v1_random:383185-383207 ATGTGTTTTTGCTGGTAGGGTGG + Intergenic
1132565230 16:619383-619405 CAGTGTGTGTGCAGGTATGGTGG + Intronic
1132771772 16:1567543-1567565 CTGTGGATGAGCAGGGAAGGAGG - Intronic
1132893725 16:2217536-2217558 CTGTATGTGTGCAGGTAGGAGGG + Intergenic
1133321857 16:4919061-4919083 CGGTGTGTGTGTGGGGAGGGGGG - Intronic
1133744436 16:8675765-8675787 GTGTGTTGGGGCAGGGAGCGGGG - Intronic
1133762759 16:8813202-8813224 CTCAGTTTGAGCAGGGCGGGTGG - Intronic
1134409619 16:13993141-13993163 CTGTGATCATCCAGGGAGGGAGG + Intergenic
1134446922 16:14337969-14337991 CTGTGTTTGTGTGGGAAGAGGGG - Intergenic
1135226944 16:20669003-20669025 CAGTGGTTGTGCAGAGCGGGTGG + Intronic
1135586129 16:23672497-23672519 CTGTGTTTTGGTAGGGAGGGAGG + Exonic
1135778225 16:25275817-25275839 CTGTGCATGTGTAGGGAAGGGGG + Intergenic
1135964535 16:27024866-27024888 CTGTGTGTGTGGGGGGGGGGGGG - Intergenic
1136851986 16:33619435-33619457 GTGTGTGTGTGTAGGGAGAGGGG + Intergenic
1137041800 16:35620058-35620080 CTGTGGTGGAGCAGGGTGGGGGG + Intergenic
1137063802 16:35815578-35815600 GTGTGTTGGGGCAGGCAGGGAGG - Intergenic
1137425490 16:48376701-48376723 TTGAGTTTGTGAGGGGAGGGGGG - Intronic
1138432190 16:56976020-56976042 TTGTGTATGTGCAAGGAGAGAGG - Intronic
1139099173 16:63744560-63744582 CAGTGCTGGTGCAGGGCGGGTGG - Intergenic
1139825969 16:69757423-69757445 CTGTGTTTGGCCAGGTAGAGAGG - Intergenic
1139851499 16:69953373-69953395 CTGAGTGGATGCAGGGAGGGGGG - Intronic
1139880475 16:70176285-70176307 CTGAGTGGATGCAGGGAGGGGGG - Intronic
1140553213 16:75890485-75890507 CTTTGACTGTGCAGGGAGAGGGG + Intergenic
1141028329 16:80568429-80568451 GTGTGGTTGAGTAGGGAGGGTGG - Intergenic
1141028433 16:80568735-80568757 GTGTGTTTGAGTGGGGAGGGTGG - Intergenic
1141949304 16:87330452-87330474 CCGTGTGCGTGCAGGGAGGAAGG + Exonic
1141973260 16:87496513-87496535 CTGTGGTTGTGCAGGGTTGAAGG + Intergenic
1142287220 16:89176368-89176390 CTGTGGTTTTGCAGGGGGAGGGG + Intronic
1142363654 16:89638796-89638818 GTGTGTGTGTGCAGGGGTGGGGG - Intergenic
1142419704 16:89962858-89962880 CTGTGGCTGTGCAGGGCTGGTGG + Intronic
1143029779 17:3961492-3961514 GTGTCTGTGTGCAGTGAGGGAGG + Intronic
1143584071 17:7842750-7842772 CTGTGTGTGTTCAGGGAGGCGGG + Intronic
1143608026 17:8002408-8002430 CTGCTTTTGTGCAGGGGTGGTGG + Intergenic
1143877794 17:10005546-10005568 CTGTGTTCATGCAGGAAGGTGGG + Intronic
1144030733 17:11320329-11320351 TGGTGTTTGTGCATGGGGGGTGG + Intronic
1145325703 17:21822513-21822535 CAGTGTTGGTGCAGTGAGGGAGG - Intergenic
1145889815 17:28406388-28406410 GTGTGTCTGGGCCGGGAGGGAGG - Intronic
1146449716 17:32963114-32963136 GTGTGTGTGTGTATGGAGGGAGG + Intergenic
1146589722 17:34118375-34118397 ATGTGTATGTGCTGGGAGTGGGG + Intronic
1146644567 17:34568480-34568502 CTGTGTCTCTGCAGCCAGGGAGG - Intergenic
1146778751 17:35647388-35647410 TTGTGTGTGTGTGGGGAGGGGGG - Intronic
1148290411 17:46443186-46443208 CTGTGCTTGTGGACTGAGGGAGG - Intergenic
1148312579 17:46660759-46660781 CTGTGCTTGTGGACTGAGGGAGG - Intronic
1148836051 17:50466509-50466531 CAGTGTTTGTGCAGGGATTGTGG - Intronic
1149430456 17:56593157-56593179 CGGTGTTTGGGGAGGGGGGGCGG - Intergenic
1149637953 17:58185404-58185426 CTGAGGGTGTGCAGGGAGGAGGG - Intergenic
1150148569 17:62791821-62791843 TTGTTTTTGTGCGGGGCGGGTGG + Intronic
1150293908 17:63998097-63998119 CTGGGTTAGTGCGGGGAAGGGGG - Intergenic
1151208933 17:72529287-72529309 CTGTGTGTGTGTAGGGGGGTGGG - Intergenic
1151366742 17:73622528-73622550 CAGTGTTTGAGGAGGGAGGGAGG + Intronic
1151385989 17:73755760-73755782 ATGTGTATGTGCAGAGAGTGTGG - Intergenic
1152036150 17:77874361-77874383 TGGTGATGGTGCAGGGAGGGAGG - Intergenic
1152239680 17:79154895-79154917 CTGTGGAAGAGCAGGGAGGGAGG - Intronic
1152251270 17:79213849-79213871 CTGGGCTTGTGCATGGAGTGTGG - Intronic
1152270350 17:79320910-79320932 CTCTGAATGTGCAGGGAAGGTGG - Intronic
1152851646 17:82639964-82639986 CTGTGTGTGGGTCGGGAGGGTGG + Intronic
1153028739 18:693681-693703 CTGTGCTCATGCAGGCAGGGTGG - Intronic
1153706516 18:7750977-7750999 CTGTCCTTCTGCGGGGAGGGGGG - Intronic
1154259798 18:12820693-12820715 CCGCGTGTGTGTAGGGAGGGGGG - Intronic
1154493112 18:14936404-14936426 ATGCGTTTGTGGAGGGAGGGAGG - Intergenic
1155057126 18:22194712-22194734 ATGTGTGTGTGTTGGGAGGGGGG - Intronic
1155307541 18:24493323-24493345 CTGTGTGTGGGCGGGGGGGGGGG - Intergenic
1156352211 18:36311200-36311222 ATGTGTCTGGGCAGGGAGGGCGG + Intronic
1157184621 18:45528171-45528193 GTGTGTGTGTGCGGGGGGGGGGG + Intronic
1157492740 18:48135957-48135979 CTGTGTCTGTGCCGGCAGGCGGG - Intronic
1157881472 18:51325039-51325061 CTGTGTGTGGGCAGAGAGGTGGG + Intergenic
1158315973 18:56211447-56211469 GTGTGTGTGTGTAGGGAGGAAGG - Intergenic
1158395924 18:57078316-57078338 GTGTGTGTGTACAGGGAGGGAGG - Intergenic
1158667995 18:59450026-59450048 CTGTGTTTATGCAGAAAGTGGGG - Intronic
1159388652 18:67759550-67759572 CTGGGTTGGAGCAGGGAAGGGGG - Intergenic
1160527114 18:79544510-79544532 CTCTGTGTGTGGAGGGTGGGCGG + Intergenic
1160730357 19:639236-639258 GTGTGTTTGGGCAGGTAGGTGGG - Intergenic
1160731323 19:642878-642900 CTGTGTGTGTGTATGGCGGGGGG - Intronic
1160745721 19:709902-709924 CTGTGTGTGTGGGGGGGGGGTGG + Intronic
1161349889 19:3785774-3785796 CTGTGTGTGTGCCGGGGGCGGGG - Intronic
1161726029 19:5929575-5929597 CTGTGTGTGTGTGGGGCGGGAGG + Intronic
1163239768 19:16053600-16053622 CTTTTTTTGTGGGGGGAGGGGGG + Intergenic
1163326296 19:16605551-16605573 CTGTGTGTGTGCAGTGAGTGGGG - Intronic
1163448293 19:17360604-17360626 CTGGGTCTGTGGAGGGAGAGAGG + Exonic
1164223462 19:23219229-23219251 CTGTGTGTTTGCAGGCAGAGAGG + Intergenic
1165258777 19:34596246-34596268 CTGTGGCTGAGCAGGGAGGATGG + Exonic
1165320087 19:35079883-35079905 CTGTGTGAGTGCAAGGAGGCTGG + Intergenic
1165935223 19:39384938-39384960 GGGTGATAGTGCAGGGAGGGTGG - Intronic
1166019544 19:40013584-40013606 CTGTGTTGGGGCAGGGATGGGGG - Intronic
1166179349 19:41095949-41095971 CTGTGCTGGTGCAGGGCTGGTGG + Exonic
1166445685 19:42855955-42855977 CTGTGTGTGTGTGGGGGGGGGGG - Intronic
1167123952 19:47536578-47536600 TTGTTTTTATGTAGGGAGGGGGG - Intronic
1167423135 19:49415393-49415415 CTGTGTGGCTGCAGGCAGGGGGG - Intronic
1167659110 19:50785642-50785664 CTGTGTTTCAGAAGGGAGTGGGG - Intergenic
1168450747 19:56464718-56464740 TTGTGTGTGTTTAGGGAGGGGGG - Intronic
925018397 2:548991-549013 CTTTGTTTCAGCAGGGATGGTGG + Intergenic
925291199 2:2749763-2749785 ATGTGTGTGTGTAGGGATGGGGG + Intergenic
925291212 2:2749808-2749830 GTGTGTGTGTGTAGGGATGGGGG + Intergenic
925291219 2:2749836-2749858 ATGTGTGTGTGTAGGGATGGGGG + Intergenic
925291233 2:2749888-2749910 ATGTGTGTGTGTAGGGATGGGGG + Intergenic
925291246 2:2749933-2749955 GTGTGTGTGTGTAGGGATGGGGG + Intergenic
925291253 2:2749961-2749983 ATGTGTGTGTGTAGGGATGGGGG + Intergenic
925291267 2:2750013-2750035 ATGTGTGTGTGTAGGGATGGGGG + Intergenic
925363219 2:3294271-3294293 GTGTGTGTGTGTAGGGAGGATGG - Intronic
925363263 2:3294475-3294497 GTGTGTGTGTGTAGGGAGGATGG - Intronic
925363456 2:3295420-3295442 GTGTGTGTGTGCAGAGAGGATGG - Intronic
925363602 2:3296128-3296150 GTGTGTGTGTGCAGAGAGGATGG - Intronic
925363724 2:3296716-3296738 GTGTGTGTGTGTAGGGAGGATGG - Intronic
925833334 2:7917981-7918003 TTGTATTTGTGCAGGGGGGGTGG + Intergenic
925906848 2:8544841-8544863 CTGCCTTGGTGCAGAGAGGGTGG - Intergenic
926045424 2:9706309-9706331 GTGAGATTGTGCAGGAAGGGAGG + Intergenic
926104426 2:10141551-10141573 CTGTGGTTGTGCTGGAATGGAGG + Exonic
926622624 2:15060615-15060637 CTGGGTCAGTGCAGGGAGGATGG + Intergenic
927291833 2:21412357-21412379 GTGTGTGTGTGGAGGGGGGGTGG - Intergenic
927703951 2:25285748-25285770 CTTTGCTTAAGCAGGGAGGGAGG - Intronic
927851381 2:26502116-26502138 CTCTGCTTTTGCAGGGAGAGAGG + Intronic
927904998 2:26849259-26849281 CTGGGTTTGAGGAGGGAGGACGG + Intronic
927917733 2:26947524-26947546 CTGTGTAGGGGCAGGGATGGGGG + Exonic
929026425 2:37607884-37607906 CTGTGTGTGTGTGGGGAGGCGGG - Intergenic
929170397 2:38926685-38926707 CTGGGGTTCTGCAGGGAGGAAGG + Intronic
932462740 2:71893843-71893865 CTGTGTTCCGCCAGGGAGGGAGG + Intergenic
932491828 2:72127532-72127554 CTCTGTTTGTCCAGGGATTGGGG - Intergenic
932664615 2:73686867-73686889 CTGTGTTTGTGAATTGGGGGAGG - Intergenic
933293762 2:80467227-80467249 CTGTCTTTGTGCATGAAGGATGG - Intronic
933615883 2:84482107-84482129 CTGTGTTTGTGTCAGGAGGTGGG - Intergenic
933979156 2:87536564-87536586 CTGTGTTCTCCCAGGGAGGGGGG - Intergenic
934555098 2:95282918-95282940 CTGTGTTTGGGGAGGGCGAGGGG - Intronic
936314671 2:111414228-111414250 CTGTGTTCTCCCAGGGAGGGGGG + Intergenic
936374327 2:111927768-111927790 GTGTGTGTGTGCAGGGAGTAGGG - Intronic
936724367 2:115294894-115294916 CTGTGTCTGTGTCGGGAGGAGGG - Intronic
937038691 2:118803866-118803888 CAGTGTTTGGGCAGGTGGGGCGG - Intergenic
937718598 2:125063939-125063961 GAGTGTTTGTGTGGGGAGGGTGG + Intergenic
937855131 2:126666698-126666720 GTGTGTGTGTGTAGGGAGGGAGG - Intronic
937862827 2:126724398-126724420 GTGTGTTTGTGGAGGAAAGGAGG - Intergenic
937916403 2:127101182-127101204 GGGTGTTTGTGCAGGGCAGGTGG - Intronic
938192313 2:129294992-129295014 GTGTGTGTGTGCAGAGAGAGTGG + Intergenic
938484133 2:131686428-131686450 CTGTGTTTGAACAGGTAGGTTGG + Intergenic
940265675 2:151833271-151833293 CTGTGTTTTTGTAGGGATGGTGG - Exonic
940663977 2:156584110-156584132 CTGTGTGTGTGTCGGGATGGGGG - Exonic
940694372 2:156959866-156959888 CTGAGCCTGTGGAGGGAGGGAGG + Intergenic
941010457 2:160293696-160293718 AGGTGTTTGTGCAGGGAGTCAGG + Intronic
942655176 2:178207716-178207738 CTGTGTTTGTCTGGGGAGGAGGG + Intronic
942986426 2:182148268-182148290 CTGTGTGTGTGGAGGGGGGTGGG + Intronic
943560360 2:189454176-189454198 CTGTGTTGGAGAAGGGAGGCCGG + Intronic
943745657 2:191460355-191460377 GTGTGTGTGTGGAGGGATGGTGG - Intergenic
943927149 2:193799657-193799679 TTGTGTCTATGCAGGGAGGAGGG - Intergenic
944014560 2:195019558-195019580 GTGTGTGTGTGTATGGAGGGGGG - Intergenic
944402601 2:199345417-199345439 ATGAGTTTGTGGGGGGAGGGGGG - Intronic
945072329 2:206004339-206004361 CTGTGTGTTTGCAGGCAGGTGGG - Exonic
945592925 2:211756103-211756125 GTGTGTGGGTTCAGGGAGGGGGG + Intronic
946071260 2:217036112-217036134 CTGACTCTGTGCAGGAAGGGTGG + Intergenic
946228763 2:218278999-218279021 CTGTGGTTGGGCAGGGAGGCAGG - Intronic
946714000 2:222534142-222534164 TTGTGTTTGTGGAGGAAGGAGGG + Intronic
946735088 2:222745876-222745898 GTGTGTGTGTGTGGGGAGGGGGG - Intergenic
946748047 2:222864814-222864836 CTGTGTCTTTGCTGGGAGGAGGG + Intronic
946914979 2:224509503-224509525 CTGCTTTTGTCCAGGCAGGGTGG - Intronic
947020284 2:225666854-225666876 CTGTGTGTGTGTTGGGGGGGTGG - Intergenic
947053800 2:226077407-226077429 CAGTGTTTGGGCTGGGAGGTGGG - Intergenic
947137813 2:226992728-226992750 CTGGGTTTGGGCAGGAAGGGCGG + Intronic
947386484 2:229595664-229595686 CAGTGTTTGTGCAGTCAGTGAGG - Intronic
947709818 2:232306560-232306582 CTGTGTTTGTGTTGGGAAGGAGG + Intronic
948131888 2:235607189-235607211 CTGGGTCTGGGCAGGGAAGGGGG - Intronic
949050627 2:241895659-241895681 CTGTGTGGGTGGATGGAGGGGGG + Intronic
1169039841 20:2483969-2483991 CCTTATTTGTGCAGGGAGTGTGG - Exonic
1169046334 20:2537040-2537062 CTGTCTCTGTGCAGGGCAGGGGG + Intronic
1169927594 20:10799135-10799157 CTGTGTGTGTTGGGGGAGGGGGG + Intergenic
1170026421 20:11893008-11893030 ATGTGTTTGGGCAGGGAAGTAGG - Intronic
1170161659 20:13319731-13319753 GTGTGTGTGTGCAGGGGGGAGGG - Intergenic
1170241978 20:14176365-14176387 ATGTGTTTGTGCAGTTAAGGTGG + Intronic
1170372675 20:15666763-15666785 CTGTGGTTGTGCAGGGGTGCTGG - Intronic
1171017874 20:21557967-21557989 CTGTGGCTGTGCAGGAAGGTGGG + Intergenic
1171175951 20:23050737-23050759 CTGTGGATGGGCAGGGTGGGGGG + Intergenic
1172488188 20:35312543-35312565 CTGTGAGAGTGCAGGGAGGATGG + Intronic
1173070571 20:39760733-39760755 CTGTGTATGTGCAGGGGCAGTGG + Intergenic
1173504121 20:43573771-43573793 CTGTGTTTGGGTATGGTGGGTGG + Intronic
1174080552 20:47968385-47968407 CTGTGTGTGTGTGGGGGGGGGGG - Intergenic
1174103101 20:48142201-48142223 CTGTGTATGAGGAGGGAGGAGGG - Intergenic
1174500133 20:50978241-50978263 CGGACTGTGTGCAGGGAGGGAGG + Intergenic
1174503371 20:51001546-51001568 CTGGGGTTGTGCAGGGAAGCCGG - Intergenic
1175267503 20:57711384-57711406 CTGTGCCTGTGCAGGGAGAGCGG - Intronic
1175408198 20:58748787-58748809 CTGTGGTTGGGGAGGGAGGGAGG - Intergenic
1175533420 20:59690234-59690256 CTGTGTTTGTGCATGGTAGGCGG - Intronic
1175548858 20:59802602-59802624 GTGTCTGTGTGCAGGGAGCGTGG + Intronic
1175989404 20:62780216-62780238 CTGGGCTTGGGCAGGGAGCGGGG - Intergenic
1176023562 20:62974703-62974725 CTGTGCTCGTGCATGGAGTGGGG + Intergenic
1176233728 20:64044698-64044720 CTGTGCTGGTGCTGGGAGAGGGG + Intronic
1177355982 21:20008365-20008387 GTGTGTGTGTGTAGGGAGGTAGG - Intergenic
1177836849 21:26193986-26194008 CAGGATTTGTGCAGGGATGGGGG + Intergenic
1178533272 21:33392672-33392694 CTGGGTGTGTGTTGGGAGGGGGG + Intergenic
1178635561 21:34299196-34299218 GTGTGCTGGTGCAGGGAGGCAGG + Intergenic
1179094661 21:38301935-38301957 CTGTGTGTGTGCTTGGTGGGGGG - Exonic
1179884271 21:44306771-44306793 CTGTGTGTGTGCAGGGAGTGGGG + Intronic
1180209772 21:46287851-46287873 GTGTGGTTGTGCCGGGCGGGAGG + Intronic
1180485218 22:15788918-15788940 CTGTGTTTGAACAGGTAGGTTGG + Intergenic
1181396804 22:22628763-22628785 CTGAGCAGGTGCAGGGAGGGAGG + Intergenic
1181472454 22:23149182-23149204 CTGTGGCTGTGCAGGGGTGGGGG + Intronic
1181499497 22:23307811-23307833 CTGAGCAGGTGCAGGGAGGGAGG + Intronic
1181594023 22:23902782-23902804 CAGTGTTTCTGCTGGGAGTGGGG + Intergenic
1181704927 22:24644321-24644343 CTGAGCAGGTGCAGGGAGGGAGG + Intergenic
1181730554 22:24843313-24843335 ATGTGTTTCTGCAGAGAAGGTGG + Intronic
1182476967 22:30581670-30581692 CAGTGTGGGTGCAGGGATGGGGG + Intronic
1182517914 22:30869431-30869453 CTGTGTTCCTGCAGGGAGATCGG + Intronic
1182622293 22:31624810-31624832 CTGCATTTGTGCTGGGAGGGTGG - Intronic
1182741329 22:32570144-32570166 CAGTGTGTGTGGAGGGAGGTTGG - Intronic
1182758363 22:32699520-32699542 TGGTGTGTGTGCAGGGATGGGGG + Intronic
1183026361 22:35068407-35068429 CTGTGTGTCTGCAGGCAGGAAGG + Intronic
1183391063 22:37545957-37545979 CTGGGATTGTGCAGGCAGCGGGG + Intergenic
1183506775 22:38213923-38213945 CTCTGCATGGGCAGGGAGGGAGG - Intronic
1184189996 22:42888062-42888084 CTCTGCTTGTGTAGGGAGAGGGG - Intronic
1184207415 22:43014311-43014333 GTGTGTGTGTGTAGGGCGGGGGG - Intronic
1184246807 22:43239955-43239977 CTGCGTTTCTGCAGGCTGGGGGG + Intronic
1184341768 22:43890074-43890096 CTGTGGGTGTGCAGGGAAGGAGG + Intronic
1184417986 22:44363288-44363310 CTTTGTGGGGGCAGGGAGGGCGG + Intergenic
1184835651 22:47019553-47019575 GTGTGGGTGTGCAGGGAGGGAGG + Intronic
1185048601 22:48541606-48541628 CTGTGTCGGTGTTGGGAGGGTGG + Intronic
1185088337 22:48752661-48752683 CTGGGTTTCTCCTGGGAGGGAGG + Intronic
1185110545 22:48897917-48897939 CTGTGCTTGGGCAGGGGTGGAGG - Intergenic
1185162273 22:49237106-49237128 CGCTTTTTGTGCAGGGAGGCCGG - Intergenic
1185275942 22:49950305-49950327 CTGTGCTACTGCAGGGCGGGAGG - Intergenic
1185288657 22:50013480-50013502 CTGTGCCTGTCCAGGAAGGGAGG - Intergenic
949881453 3:8664133-8664155 CTGTGTTTCTCTAGGGAGAGAGG + Intronic
950103282 3:10371546-10371568 CTGTGTGTGGGCAGGGGGAGTGG + Intronic
950115454 3:10447833-10447855 TTTTGTTTTGGCAGGGAGGGTGG - Intronic
950289643 3:11773242-11773264 CTGGGTTTGGCCAGGGATGGTGG - Intergenic
951052066 3:18105052-18105074 GTGTGTGTGTGCTGGGAGAGGGG + Intronic
951453297 3:22863777-22863799 GTGATTTTTTGCAGGGAGGGAGG + Intergenic
952920928 3:38283359-38283381 ATGTGTGTGTGCTGGGAGGTGGG - Intronic
952980121 3:38727536-38727558 CTGTGGCTCTGCAGGGATGGTGG + Intronic
953029856 3:39172089-39172111 CTGGGTTGGGGCAGGGATGGAGG + Intergenic
953411737 3:42694169-42694191 CTGGGTTTGAGCAGGGATAGGGG - Intronic
953705677 3:45228059-45228081 CTTTGTCTGTGCAGGGGGGAAGG + Intergenic
953865780 3:46582029-46582051 CTGCGTGTGTGCAGGGAGACTGG + Exonic
954156453 3:48687481-48687503 GCGTGTTTGGGCAGGTAGGGTGG - Intergenic
954372019 3:50174037-50174059 CAGTGTATCTGCAGAGAGGGGGG - Exonic
954853004 3:53619058-53619080 CGTTGTTTCTGCATGGAGGGAGG - Intronic
955744027 3:62122134-62122156 CTATGTTTTTTCAGGGTGGGGGG - Intronic
956182448 3:66530136-66530158 CTGAATTTGTGCAGGGAGCTAGG + Intergenic
956534936 3:70265485-70265507 GTGTGTGTGTGCAGGGAGTATGG - Intergenic
957413416 3:79869581-79869603 TTGGGTTTGTTCAGGGAGAGAGG - Intergenic
957954101 3:87161384-87161406 CTGTGTGTGTGTAGGGTAGGGGG - Intergenic
958777415 3:98502884-98502906 CGTTGTTTGTGAGGGGAGGGAGG + Intronic
959558162 3:107747245-107747267 GTGTGTTTGTGTTGGGTGGGAGG + Intronic
959863899 3:111244253-111244275 GTGTGTGTGTGTAGGGTGGGAGG + Intronic
960052662 3:113252828-113252850 CTGTGAGTGCTCAGGGAGGGAGG + Intronic
960936931 3:122910192-122910214 CTGTGTTTGTTCAGGGGGCTTGG + Exonic
960968138 3:123119753-123119775 CTGTGTTTCAGCAGCGAGGAGGG - Intronic
961029230 3:123587501-123587523 CTGTGTGTGTGTTGGGGGGGGGG - Intergenic
961175189 3:124829691-124829713 CTGTGTTTCCTCAAGGAGGGAGG - Intronic
961450665 3:127000955-127000977 CTGTGTGTGTGAAGGGGTGGAGG + Intronic
961681833 3:128604559-128604581 CTGTGTTTCTGCAGCCAGGCAGG + Intergenic
961705647 3:128783208-128783230 GTGTGTTTGTGGGGGGCGGGGGG - Intronic
961793818 3:129395202-129395224 CTGTTCTTGTGCAGGCATGGTGG + Intergenic
963215021 3:142735782-142735804 GTGTGTGTGTGTTGGGAGGGTGG + Intronic
964289652 3:155163180-155163202 CTATGTGTGTGTATGGAGGGAGG - Intronic
964327552 3:155563606-155563628 GTGTGTTTGTGGAGGGAGAAGGG - Intronic
964465745 3:156989810-156989832 CTGTGTGTGTGCAGAGAGAGAGG - Intronic
965489767 3:169321676-169321698 GTGGTTTTGTGGAGGGAGGGTGG + Intronic
965919484 3:173895061-173895083 CTTTTTTGGTGCCGGGAGGGGGG + Intronic
966053801 3:175656743-175656765 GTGTGTGTGTGCAGGGGGCGAGG + Intronic
968572447 4:1349038-1349060 GTGTGTTTGTGCCGGGCGGTTGG + Intronic
968605089 4:1531719-1531741 CTGCCTGTGGGCAGGGAGGGAGG - Intergenic
968605760 4:1534561-1534583 CTGTGCTTCTGCAGGAGGGGAGG + Intergenic
968978517 4:3834427-3834449 CTGTGTGGGTGGATGGAGGGTGG - Intergenic
969499995 4:7546824-7546846 ATGTGTTTTTGCAGGGAAGAGGG - Intronic
969656396 4:8501202-8501224 TTGTGCATGTGCAGGGCGGGAGG + Intergenic
969870977 4:10104659-10104681 GTGTGTGTATGCCGGGAGGGAGG - Intronic
970143053 4:13003509-13003531 GTGTGTGTGTGGGGGGAGGGGGG + Intergenic
970602328 4:17650243-17650265 CTGTGAGAGGGCAGGGAGGGTGG - Intronic
970782750 4:19758543-19758565 GTGTGTTGGTGGGGGGAGGGAGG + Intergenic
971155296 4:24075262-24075284 CTGTGTTTTCACAGGGAGGAAGG - Intergenic
971372778 4:26031674-26031696 GTGTGTGTGTGTAGGGAGGCAGG + Intergenic
971582600 4:28361865-28361887 ATGAATTTGGGCAGGGAGGGGGG - Intergenic
972051480 4:34740545-34740567 CTGCATTTGTGTAGGAAGGGTGG + Intergenic
972446355 4:39148044-39148066 GTGTGTGTGTGGAGGGGGGGCGG - Intergenic
973724847 4:53764689-53764711 CAGAGTTTGGGCAGGGATGGAGG - Intronic
973779407 4:54274072-54274094 CTGTGTATGTGGATGGAGTGTGG + Intronic
975196578 4:71531744-71531766 GTGTGTGTGTGTAGGCAGGGAGG - Intronic
976470568 4:85423978-85424000 CTGTGTGTGTGGAAGGGGGGCGG + Intergenic
976893026 4:90073864-90073886 CTGTGTACGTGTAGGTAGGGAGG - Intergenic
976963996 4:91012503-91012525 CTGTGTCTGGGTGGGGAGGGTGG + Intronic
977504261 4:97882016-97882038 TTGTGTGTGTGTGGGGAGGGGGG - Intronic
977624980 4:99180224-99180246 AAGTGTTTGTGCAGGGAGTGAGG + Intergenic
977746160 4:100549938-100549960 CTGGATATGTGCGGGGAGGGGGG + Intronic
977890575 4:102306637-102306659 CTGTGTGTGTGCATTGTGGGTGG + Intronic
978063700 4:104370058-104370080 CAGTGTTTGTTCAAGCAGGGTGG - Intergenic
979213646 4:118136616-118136638 CTGTGTTTCTGAAGGGTGAGAGG - Intronic
979835318 4:125359798-125359820 CTGTGTGTTTGTGGGGAGGGAGG + Intronic
980098080 4:128513691-128513713 ATGTGTGAGTACAGGGAGGGAGG - Intergenic
980693309 4:136323703-136323725 ATGTGTGTGTGGAGAGAGGGAGG + Intergenic
980975227 4:139604691-139604713 CAGTGCTTGTGCAGGGGGAGAGG - Intronic
980986093 4:139695878-139695900 CTGTGTGTGTGTGGGGCGGGGGG - Intronic
981025459 4:140073019-140073041 GTGTGTTTGTCTAGGGAGGGAGG + Intronic
981162098 4:141510102-141510124 ATTTGTTGGAGCAGGGAGGGAGG - Intergenic
981909916 4:149967235-149967257 TTGTGTGTGTGCATAGAGGGCGG - Intergenic
981927878 4:150159301-150159323 GTGTGTATGTGCATAGAGGGTGG - Intronic
982845517 4:160247192-160247214 AAGAGTTTGTGCAGGGAGTGGGG + Intergenic
983343749 4:166500924-166500946 TTGTGTTTATGCAGGGACAGAGG + Intergenic
984521089 4:180801707-180801729 ATGTGTGTGTGTAGGGTGGGGGG + Intergenic
984943755 4:184955324-184955346 ATGTGTGTGTGGAGGGAGGAGGG + Intergenic
985362483 4:189190347-189190369 CCTTGTCTGTGCAAGGAGGGCGG + Intergenic
985445336 4:190018587-190018609 CTGTGTGTGTGTGGGGGGGGTGG + Intergenic
985481318 5:112806-112828 CTGGGTTTGTACAGGGAGGAGGG - Intergenic
985639890 5:1058683-1058705 CTGTCTGTGTCCAGAGAGGGAGG - Intronic
985640157 5:1059806-1059828 GAGTGAGTGTGCAGGGAGGGAGG - Intronic
985669786 5:1201361-1201383 GTGCGTTTGTGCAGGGGGAGGGG + Intergenic
985673822 5:1219984-1220006 GTGTGTGTGTGCAGGGGGGTGGG + Intronic
985852603 5:2399656-2399678 CTGTGTTTGTGGAGTGGGAGGGG - Intergenic
985877833 5:2613543-2613565 GTTTGACTGTGCAGGGAGGGAGG - Intergenic
986592239 5:9383058-9383080 CTGTGCTTGGGCAGGGATTGTGG - Intronic
987337849 5:16912791-16912813 GTGTGTGTGTGCAGGGTGGTAGG - Intronic
988093396 5:26569913-26569935 ATTTGTTTGTGCGGGGATGGCGG - Intergenic
988435369 5:31168144-31168166 CTGTGTGTGTGAAGGGGTGGGGG - Intergenic
988636883 5:32994543-32994565 GTGTGTGTGTGTAGAGAGGGAGG - Intergenic
989168874 5:38455906-38455928 CTGTGTACGTGAAGGGAGGCTGG - Intronic
990182313 5:53174602-53174624 CTGTGCTTGTGTGGGAAGGGAGG - Intergenic
990497533 5:56363487-56363509 TTGTGTGTGTGCAGGGAGGAGGG - Intergenic
991385026 5:66077747-66077769 GTGTGTGTGTAGAGGGAGGGAGG - Intronic
993038230 5:82781986-82782008 GTGTGTGTGTGTAGGGAGTGTGG + Intergenic
993275399 5:85850501-85850523 CTGTGGTTATGCAGGGCAGGGGG + Intergenic
993478844 5:88397666-88397688 GGGTGTTGGTGAAGGGAGGGTGG - Intergenic
993838536 5:92846722-92846744 CTCTTTTTCTGCAGGGGGGGTGG - Intergenic
995182986 5:109246191-109246213 CTGTGTATGTGCCAGGGGGGTGG + Intergenic
995603937 5:113830478-113830500 CTGTGTTTGGGCAGGGGGTGAGG + Intergenic
995846376 5:116498554-116498576 CTGTGAGTGTGCATGGGGGGAGG + Intronic
996122006 5:119683113-119683135 TTGTGTTTGTGCAGGTAGGTTGG + Intergenic
996351155 5:122543259-122543281 CAATGTTTGTGCAGGGAGAAGGG - Intergenic
996826225 5:127684104-127684126 CTGTGTGTGTGCAGAGAAAGAGG + Intergenic
996832411 5:127754525-127754547 CTGTGTGTGTGTGGGGTGGGGGG - Intergenic
997794320 5:136793127-136793149 TTGTGTTTGTACAGGCAGGATGG + Intergenic
998406131 5:141875888-141875910 CTGTGTTTGTAGGGGGTGGGGGG - Intronic
998434443 5:142095610-142095632 CTGTGTTTTGGAAGGGAGGAGGG + Intergenic
998538341 5:142955126-142955148 GTGTGTGTGTGCAGAGATGGGGG - Intronic
999254235 5:150200929-150200951 CTGGGTGTGTGAAGGGAGGAGGG + Intronic
999268799 5:150284471-150284493 GTGTGCTTGTGGAGGGAGGTGGG + Intronic
999376050 5:151087157-151087179 CTGTGCTTCTGCAGGAAGGAGGG + Exonic
999651659 5:153774067-153774089 GTGTGTGTGTGGGGGGAGGGGGG - Intronic
1000227856 5:159285185-159285207 GTGTGTGTGTGGTGGGAGGGTGG - Exonic
1000571817 5:162924191-162924213 GTGTGTTTGTGGAGGGAAGGAGG + Intergenic
1001597932 5:172909978-172910000 CTGATTTGGTGCAGGGAGGTGGG + Intronic
1001827065 5:174753525-174753547 GTGTGTGTGTGTAGGGAGGGAGG + Intergenic
1002083942 5:176757946-176757968 GTCTATTTGAGCAGGGAGGGTGG + Intergenic
1002192045 5:177483462-177483484 CTGTGGTGGTGGAGGGAGTGGGG + Exonic
1002936596 6:1679071-1679093 CTGTGTGTGTGCGGAGAGAGAGG - Intronic
1002999324 6:2316811-2316833 CTGTGTGTGTGTGTGGAGGGTGG + Intergenic
1003021200 6:2511046-2511068 CTGTGTGTTTGCGGGGACGGGGG - Intergenic
1003110752 6:3250380-3250402 CTGTGCTTGTGAAGGGTGAGTGG + Intronic
1003188883 6:3855637-3855659 GCATCTTTGTGCAGGGAGGGTGG + Intergenic
1003293413 6:4802816-4802838 GTGCACTTGTGCAGGGAGGGTGG + Intronic
1003545717 6:7056647-7056669 CTGGGTGTGTTCTGGGAGGGTGG + Intergenic
1003659027 6:8043185-8043207 CTCATTTTGGGCAGGGAGGGTGG - Intronic
1003754135 6:9096780-9096802 GTGTCTTTGTGCATGGTGGGAGG + Intergenic
1004879612 6:19994898-19994920 CTGTGTGGTTGCAGGGTGGGAGG - Intergenic
1005103278 6:22197023-22197045 TTGTGTTTGTTCATGGCGGGTGG + Intergenic
1005214847 6:23513322-23513344 CTGTATTGGTATAGGGAGGGGGG - Intergenic
1005387011 6:25294957-25294979 CTGTGTTCCTCCAGGCAGGGTGG + Intronic
1005430407 6:25750776-25750798 TTGTGTGTGTGGGGGGAGGGGGG + Intergenic
1005573796 6:27173044-27173066 GTGTGTTTGTGTAGGGGAGGAGG + Intergenic
1006004094 6:30988776-30988798 CTGTGTGTGGGGGGGGAGGGGGG + Exonic
1006175240 6:32117451-32117473 CTGTGGGTGGGCAAGGAGGGTGG - Intronic
1006710583 6:36065749-36065771 ATGTGTTTGTGTGGGGAGGAAGG - Intronic
1006917361 6:37603145-37603167 GTGTGTGTGTGGAGGGGGGGCGG + Intergenic
1007079908 6:39092600-39092622 GTGTGTATGTGTTGGGAGGGTGG - Intergenic
1007481429 6:42152889-42152911 CTGTGTGTGTGCAAGGTGTGGGG + Intergenic
1007521648 6:42454652-42454674 GTGTGTGTGTGCTGGGAGGGAGG - Intergenic
1007592039 6:43027715-43027737 CTGTGTGTGTGTTGGGGGGGGGG - Intronic
1008453527 6:51681337-51681359 CTGTGTTTATTCAGGGTTGGTGG - Intronic
1008781729 6:55114582-55114604 CTGTTTTTGTGCAAGGTAGGTGG - Intronic
1010331659 6:74630130-74630152 AGGTGTTTGGGGAGGGAGGGAGG - Intergenic
1010379709 6:75210045-75210067 CTTTGCTAGTGCAGAGAGGGTGG - Intergenic
1010972403 6:82276837-82276859 GTGTGTGTGTGTAGGCAGGGAGG + Intergenic
1011337326 6:86275793-86275815 CAGTGTTGGTGCAGGGGTGGGGG + Intergenic
1011493375 6:87915348-87915370 ATGTGTGTGTGGAGGGTGGGAGG + Intergenic
1012276851 6:97284472-97284494 GTGTGTGTGTGCAGAGAGAGAGG - Intergenic
1012546083 6:100420951-100420973 CTGTGTCTCTGCAGGGTGGGAGG + Exonic
1014107339 6:117582263-117582285 GTGTGTGTGTGTAGGGGGGGAGG - Intronic
1014120398 6:117718915-117718937 GTGTGTGTGTGAAGGGATGGGGG + Intergenic
1015578968 6:134702701-134702723 TGGTGTTCCTGCAGGGAGGGTGG + Intergenic
1015890887 6:137968587-137968609 CTGTGTGAGTGTAGGGAGAGGGG + Intergenic
1017548571 6:155479442-155479464 CTGCACTTGTGGAGGGAGGGAGG + Intergenic
1018549716 6:164981782-164981804 CTGTGTTTGTACAGGGTAGAAGG - Intergenic
1018676824 6:166229476-166229498 CTGTGTGGGTGGGGGGAGGGAGG + Intergenic
1018786527 6:167112654-167112676 CTGGCTTTGTGCAGGGAGGTTGG + Intergenic
1019067602 6:169315441-169315463 GTGTGTGTGTGGACGGAGGGAGG - Intergenic
1019067638 6:169315757-169315779 GTGTGTGTGTGGACGGAGGGAGG - Intergenic
1019092723 6:169553020-169553042 GTGTGTGTATGCAGGGAGGTGGG + Intronic
1019092736 6:169553088-169553110 GTGTGTGTATGCAGGGAGGTGGG + Intronic
1019487888 7:1297570-1297592 CTGCCTTTGTGCAGGGGGTGGGG + Intergenic
1019705722 7:2496329-2496351 CTGTGTTTGTGCAGGAGCAGAGG - Intergenic
1019711740 7:2521111-2521133 CGGGGTTTGAGCAGGGAGGAAGG - Intronic
1019922935 7:4174373-4174395 CTGTCCTGGTACAGGGAGGGAGG + Intronic
1020556192 7:9673475-9673497 GTGTGTGTATGCAAGGAGGGTGG + Intergenic
1021088805 7:16456271-16456293 GTCTGCTTGGGCAGGGAGGGTGG - Intergenic
1021097981 7:16554711-16554733 CGGTGTTTGTGAAGGTAAGGGGG - Intronic
1021201107 7:17729454-17729476 CAGTGTTTTGGCAGGGGGGGTGG - Intergenic
1021309694 7:19078588-19078610 CTGTGGGTGTGTAGGGAGAGGGG + Intronic
1021780660 7:24102811-24102833 GTGTGTTTTTGCTGGGAGTGGGG + Intergenic
1022012295 7:26319069-26319091 CTGTGTCAGTGGAGGAAGGGAGG + Intronic
1022886759 7:34654697-34654719 GTGTGTGTGTGTAGGGAGGGGGG + Intergenic
1023459163 7:40375878-40375900 CTGTGTTTGTGAATGAATGGAGG + Intronic
1023609275 7:41957357-41957379 CTTTCTTCCTGCAGGGAGGGAGG + Intergenic
1023975411 7:45025985-45026007 CTGTGTTTGTGAGGGAAGGTTGG + Intronic
1024342447 7:48281218-48281240 ATATGATTATGCAGGGAGGGAGG + Intronic
1024608225 7:51040251-51040273 GTGTGTTTTTGAGGGGAGGGGGG - Intronic
1025209577 7:57013125-57013147 CAGAGTTTGTGCATGGACGGGGG - Intergenic
1025262245 7:57426861-57426883 GTGTGTGTGTGTAGGGGGGGGGG + Intergenic
1026479341 7:70764831-70764853 CTGTGGTTGGGCAGGGAGAGGGG - Exonic
1026988448 7:74569456-74569478 GTGGGGTTGTGCAGTGAGGGGGG + Intronic
1026999580 7:74643193-74643215 CTGTGGTTGCGCATGGAGGCAGG + Intergenic
1027461146 7:78455152-78455174 ATATGTGTGTGGAGGGAGGGTGG + Intronic
1027545199 7:79519099-79519121 CTGTGCCTGTTCATGGAGGGAGG + Intergenic
1028889194 7:95967866-95967888 CTGTGTTAGTGCAGGCAGACTGG + Intronic
1029335990 7:99899733-99899755 CTGTGTCTGTGTATGGTGGGTGG + Intronic
1029418177 7:100456586-100456608 GTGTGTTTGTGGACGGCGGGAGG - Intergenic
1029446835 7:100618115-100618137 CAGTCTTTGTCCAGTGAGGGTGG - Intergenic
1030395538 7:108981579-108981601 CTGTGTATGTGGAGGTGGGGTGG + Intergenic
1031078697 7:117238311-117238333 GTATGTTTGTTCAGGGAAGGGGG + Intergenic
1031898278 7:127379850-127379872 CTGTGTGTGTGTGGGGGGGGTGG - Intronic
1031982444 7:128136422-128136444 CTGTGTCTGAGCAAGGAGGGTGG - Intergenic
1032023364 7:128422137-128422159 CTGTGTTTGTGGTGTGTGGGGGG + Intergenic
1032360820 7:131253219-131253241 TTGGGGTTGGGCAGGGAGGGAGG - Intronic
1032582556 7:133116867-133116889 CTGTGTGTGTGTGGGGAGGGGGG - Intergenic
1033277198 7:139980887-139980909 CTGTGTCTGTTCTGGAAGGGAGG - Intronic
1033327409 7:140390946-140390968 CTGCTTTGGTGCAGGGAAGGAGG - Intronic
1033821122 7:145134848-145134870 CGGTATTTGTGCAGGGGTGGAGG - Intergenic
1034749241 7:153553541-153553563 GTGTGTGTGTGGAGGTAGGGCGG - Intergenic
1035332665 7:158106463-158106485 GTGTGTGTGTGGAGGCAGGGAGG - Intronic
1035399223 7:158553919-158553941 GTGTGTTTAGACAGGGAGGGTGG - Intronic
1035487134 7:159234800-159234822 CTGTCTTCATGCAGGGAGGTTGG + Intergenic
1035869700 8:3124132-3124154 CTGTGTGCGTGTGGGGAGGGGGG + Intronic
1035956739 8:4088777-4088799 ATGTGTTTGGTCTGGGAGGGTGG - Intronic
1037062538 8:14532702-14532724 CTTTGTGTGTGGGGGGAGGGCGG + Intronic
1037118425 8:15253941-15253963 GTGTGTGTGTGAAGGGATGGGGG - Intergenic
1037338879 8:17820681-17820703 CTGTGTGTGTGTAGAGGGGGAGG - Intergenic
1038157009 8:25000562-25000584 CTGGGTTTGTGCAGGGTCAGGGG - Intergenic
1038426646 8:27468276-27468298 GTGTATGTGTGCAGGGAGGCAGG - Intronic
1038650824 8:29401779-29401801 CTGTGTGTGTGGCGGGGGGGCGG - Intergenic
1039520529 8:38167235-38167257 GTGTGTTTGTGCAGAGAAAGAGG - Intronic
1039839996 8:41286363-41286385 CTGTGTTTGTGCGGCGGGGGAGG - Intronic
1040376348 8:46828496-46828518 CTGTTTTTGAGCAGGGTGTGTGG + Intergenic
1040913587 8:52545504-52545526 AGGGGTGTGTGCAGGGAGGGAGG - Intronic
1041099727 8:54383708-54383730 TTGCCTCTGTGCAGGGAGGGAGG - Intergenic
1041117561 8:54554670-54554692 CTGTGGTTGCCGAGGGAGGGAGG + Intergenic
1041276604 8:56166363-56166385 CTGTGTTTGTGGGGGGAGCTGGG + Exonic
1042155363 8:65840387-65840409 GTGTGTGTGTGCAGGTAGTGTGG - Intronic
1043069182 8:75617374-75617396 GTGTGTTTGTGCACGGATGTGGG - Intergenic
1045535927 8:103027839-103027861 CTGTGTGTGTGCAGGGAGGGTGG - Intronic
1046838865 8:118835169-118835191 GTGTGTGTGTGTTGGGAGGGAGG + Intergenic
1046938475 8:119908169-119908191 ATGTGTAGGTGCTGGGAGGGTGG + Intronic
1047142256 8:122154366-122154388 CTGGTTTTGTGCAGGGAATGAGG + Intergenic
1047788963 8:128182798-128182820 CTGTGTTTCAGCAGAGAGGGAGG + Intergenic
1048707427 8:137169483-137169505 CTGTGTTTGTGGAACGAGGTTGG + Intergenic
1048836137 8:138520616-138520638 CTCTGCTGCTGCAGGGAGGGAGG + Intergenic
1048994220 8:139781728-139781750 CTGTGTGTGCGGTGGGAGGGAGG + Intronic
1049001263 8:139826813-139826835 CTGGGTTTCTGCAGAGAGGTTGG + Intronic
1049139058 8:140934932-140934954 CTGTGTTTATGCAGAAAAGGAGG + Intronic
1049621178 8:143598977-143598999 CTGGGCTTGGGCAGGGCGGGTGG - Exonic
1049726730 8:144150011-144150033 CTGGGTGTGTGCAGGGAGACTGG - Intronic
1051096029 9:13466050-13466072 CTGTGTGTGTGTGGGGGGGGGGG + Intergenic
1051350686 9:16195622-16195644 GTGTGTCTGTGCTGGGAGGGTGG - Intergenic
1052415136 9:28168137-28168159 GTGGGTTTGAGCAGGGAGTGTGG + Intronic
1052551426 9:29955042-29955064 GTGTGTATGTGCGGGGAGGTGGG + Intergenic
1052666097 9:31496981-31497003 CTGTGATGGGGCAGGGTGGGGGG + Intergenic
1052864692 9:33457832-33457854 GTGGGGTTGTGCAGGGAGAGAGG - Intergenic
1052922568 9:33983579-33983601 CTGTGTCTCACCAGGGAGGGCGG - Intronic
1053575970 9:39357720-39357742 CTGGGTTAGGGCAGTGAGGGAGG - Intronic
1053840485 9:42185657-42185679 CTGGGTTAGGGCAGTGAGGGAGG - Intronic
1054097539 9:60916411-60916433 CTGGGTTAGGGCAGTGAGGGAGG - Intergenic
1054118941 9:61192041-61192063 CTGGGTTAGGGCAGTGAGGGAGG - Intronic
1054588810 9:66990521-66990543 CTGGGTTAGGGCAGTGAGGGAGG + Intergenic
1055140957 9:72876559-72876581 GTGTGTCTGTGCAGGTGGGGAGG + Intergenic
1055724305 9:79211240-79211262 GTGTGTTTGTACAAGGTGGGAGG + Intergenic
1056064828 9:82923284-82923306 CTGGTTCTGTGCAGGGAGGGAGG + Intergenic
1056693904 9:88830253-88830275 CAGTGTTTGTGCAGCCAGGTGGG + Intergenic
1056932827 9:90892942-90892964 CTGAGGTTGTGCAGGGAGCCAGG - Intronic
1057015509 9:91647487-91647509 TTGTGTTTGTGCAGGGGCTGGGG - Intronic
1057143269 9:92740521-92740543 CTGTGCTGGGGCGGGGAGGGGGG + Intronic
1057178752 9:93017916-93017938 CTGTGTCTGAGCAGGATGGGAGG + Intronic
1057510899 9:95678774-95678796 CTGTGTCTGGGCAGGCATGGAGG - Intergenic
1058099734 9:100905686-100905708 CTGTGTGTGTGGGGGGGGGGGGG + Intergenic
1058617815 9:106852534-106852556 CTGTGTTTGTGTTTGGAGGCTGG - Intergenic
1059036876 9:110763690-110763712 GTGTGCCTGTGCAGGGAGGGAGG + Intronic
1059166606 9:112082599-112082621 CTGTGTTTCTTCAGGGGCGGGGG - Intronic
1059287840 9:113191711-113191733 TTGTGTGTGTGAAAGGAGGGAGG + Intronic
1059605570 9:115831245-115831267 TTGTGTGTGTGCGGGGAGGGGGG - Intergenic
1059699005 9:116757210-116757232 CTGGTTTCCTGCAGGGAGGGAGG - Intronic
1060078111 9:120613340-120613362 TTGTCTCTGTGGAGGGAGGGGGG + Intronic
1060548576 9:124474835-124474857 ATGTGATGGTGCAGGGAGGGTGG + Intronic
1060868754 9:127022254-127022276 CTGTGTGTGTGGAGAAAGGGAGG - Intronic
1061015226 9:127977502-127977524 CTGTGTGTGAGCTGGGAGTGGGG - Intronic
1061195667 9:129105969-129105991 CTGGCTGTGTGCAGGAAGGGTGG - Intronic
1061242574 9:129383115-129383137 CTGGTTTAGTGCAGGGAGGGTGG + Intergenic
1061473471 9:130845939-130845961 CTGTGTTTCTCCAAGGAGCGGGG + Intronic
1061842929 9:133370275-133370297 CCATGTTTGCGCAGGGAAGGAGG - Intronic
1061872897 9:133530098-133530120 CTGTGTGTGTGCTGGGAGGACGG + Intergenic
1061883930 9:133582139-133582161 CTGTGTGTGTGCCGAGAGGACGG + Intronic
1062176208 9:135164447-135164469 CTCTGCCTGTGGAGGGAGGGGGG - Intergenic
1062329038 9:136028751-136028773 CTGAGCCTGTGCAGGCAGGGGGG - Intronic
1062629222 9:137456196-137456218 CTGTGTGTGTGTGGGGGGGGGGG + Intronic
1185545164 X:937745-937767 GTGTGTGTGTGCAGAGATGGGGG - Intergenic
1185749201 X:2597161-2597183 TTGTGTTTGGGGAGGGTGGGCGG + Intergenic
1186038451 X:5449565-5449587 CTGTGTGTGGGGAGGGAGGTGGG - Intergenic
1186325076 X:8467179-8467201 GTGTGTGTGGGGAGGGAGGGAGG + Intergenic
1188094198 X:26002360-26002382 AAGAGTTTGTGCAGGGAGTGGGG - Intergenic
1188956063 X:36436119-36436141 AAGTGTTTGTGCAGGGAGTGGGG - Intergenic
1189911492 X:45814687-45814709 CTGTTTTGGTGAAGGGATGGTGG - Intergenic
1190062389 X:47219466-47219488 GTGTGCTTGTGGAAGGAGGGCGG + Intronic
1190441458 X:50478910-50478932 CTGTGTTTGTGCATGCACGGGGG - Intergenic
1190470239 X:50771193-50771215 CTTTGTGTGTGAAGGGAGGGTGG - Intronic
1190708937 X:53051311-53051333 CTCTGTGGGGGCAGGGAGGGGGG + Intronic
1192458087 X:71294384-71294406 CTGTGTTTGGCCAGGTAGAGAGG + Exonic
1193486221 X:82087839-82087861 CTGTGTTTGTGCAGCAACGAAGG + Intergenic
1193549415 X:82872112-82872134 AAGAGTTTGTGCAGGGAGTGGGG + Intergenic
1193963027 X:87948589-87948611 CTGTGTTTGTTCAGGAAAGGGGG - Intergenic
1194024534 X:88735640-88735662 CTGTGTCTGGGGAGGGTGGGTGG + Intergenic
1194309847 X:92292683-92292705 CTGTGTATGTGCTGGCAGGGAGG - Intronic
1194657994 X:96597004-96597026 AGGTGTGTGTGCAGGGAAGGGGG - Intergenic
1194923561 X:99796353-99796375 CTGTCTATGTGCAGGAAGAGTGG + Intergenic
1195133417 X:101877685-101877707 GTGTGTGTGTTGAGGGAGGGCGG - Intergenic
1195169249 X:102249877-102249899 GTGTGTGTGTGAGGGGAGGGGGG - Intergenic
1195189608 X:102437211-102437233 GTGTGTGTGTGAGGGGAGGGGGG + Intronic
1195280647 X:103329913-103329935 TTGTGGTTGTGCTGAGAGGGAGG - Intergenic
1195597167 X:106705081-106705103 CAATGTTTGGGCAGGGAGGTAGG + Intronic
1195975573 X:110522477-110522499 CTGCGTGTGTGCAGGGAGACTGG + Intergenic
1196198623 X:112860823-112860845 GTGTGTTTGCGGGGGGAGGGGGG + Intergenic
1196298211 X:114023588-114023610 CTGTGTGTGTGTTGGTAGGGGGG + Intergenic
1197723458 X:129760392-129760414 CTGGGTGTGTGTAGGCAGGGTGG - Intronic
1197773813 X:130107354-130107376 CTGTGTGTGGGGAGGGTGGGAGG + Intronic
1197783140 X:130176274-130176296 GTGTGTGTGTGTAGAGAGGGAGG + Intronic
1197803951 X:130381434-130381456 CTGTGTTTGGCCAGGCATGGTGG - Intergenic
1198528464 X:137525592-137525614 CTGTGTGTGAGCAGGAAGGCAGG + Intergenic
1198533995 X:137569039-137569061 ATGTGTTTGCGCAGGGAGCTCGG - Exonic
1198804617 X:140481515-140481537 CTGTGTGTAAGAAGGGAGGGAGG + Intergenic
1199229781 X:145423452-145423474 AAGTGTTTGTGCAGGGAGTGAGG - Intergenic
1199708160 X:150449118-150449140 CAGTGGTTGGGCAGGGTGGGGGG + Intronic
1199895649 X:152125121-152125143 CTGTGCATGTGCATGGAGAGAGG - Intergenic
1200016946 X:153172186-153172208 CTGTGCATGTGCATGGAGAGGGG + Intergenic
1200618140 Y:5406972-5406994 CTGTGTATGTGCTGGCAGGGAGG - Intronic
1200819146 Y:7564232-7564254 GTGTGTGTGTGCAGGGTTGGTGG + Intergenic
1201633035 Y:16091256-16091278 CTGTGTGTGGGGAGGGAGGTGGG + Intergenic