ID: 905304453

View in Genome Browser
Species Human (GRCh38)
Location 1:37007860-37007882
Sequence CACCTCCCACTGCTGCTGCT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 473
Summary {0: 1, 1: 0, 2: 5, 3: 46, 4: 421}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905304453_905304460 0 Left 905304453 1:37007860-37007882 CCGAGCAGCAGCAGTGGGAGGTG 0: 1
1: 0
2: 5
3: 46
4: 421
Right 905304460 1:37007883-37007905 GAAGTGGGGGCCCTAATGCAGGG 0: 1
1: 0
2: 0
3: 10
4: 114
905304453_905304459 -1 Left 905304453 1:37007860-37007882 CCGAGCAGCAGCAGTGGGAGGTG 0: 1
1: 0
2: 5
3: 46
4: 421
Right 905304459 1:37007882-37007904 GGAAGTGGGGGCCCTAATGCAGG 0: 1
1: 0
2: 0
3: 9
4: 144

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905304453 Original CRISPR CACCTCCCACTGCTGCTGCT CGG (reversed) Intronic
900410725 1:2511304-2511326 GGCCTCCCACCTCTGCTGCTGGG - Intronic
900625696 1:3607621-3607643 AACCTCCCACTGCTGCACATGGG + Intronic
900816751 1:4853226-4853248 CTCCTCCCCCTGCTCCTGCTTGG + Intergenic
900910638 1:5594723-5594745 CACCTCACAGGGCTGTTGCTGGG - Intergenic
901143798 1:7052162-7052184 CACGCCCCACTGCTGCTTGTGGG + Intronic
901152661 1:7114208-7114230 TCCCTCCCACTGCTGCCACTGGG - Intronic
902387240 1:16082958-16082980 CACCTCCCAGAGCTGCTGTGAGG + Intergenic
902841367 1:19076081-19076103 CACCTCCCCCTGCTGTCACTTGG + Intronic
902983982 1:20144263-20144285 CTCCTCCCACTGCTGCAGCCGGG + Intronic
903907400 1:26696483-26696505 CTCCTCCCGCTGCTGCTGCTCGG - Exonic
904300242 1:29549479-29549501 GACCCCCCACTGCTGCTCCCAGG + Intergenic
904352127 1:29915344-29915366 GACCTCCCACTGCTTCTGCTGGG - Intergenic
904413072 1:30336710-30336732 CCCTCCCCACTGCTGCTGCCGGG - Intergenic
904457993 1:30658636-30658658 GACCCCCCACTGCTGCTCCCAGG - Intergenic
904824263 1:33264390-33264412 CAGCTGCCATTGCTGTTGCTAGG - Intronic
905304453 1:37007860-37007882 CACCTCCCACTGCTGCTGCTCGG - Intronic
905412340 1:37779281-37779303 CACCTCTCCCTGCAGCTCCTCGG - Intergenic
905435316 1:37951594-37951616 CACCTCGCAGTGGTGCTGCCCGG + Intergenic
906153047 1:43598909-43598931 CACCACCCAATGCTGCACCTGGG - Exonic
906608973 1:47189316-47189338 CACCTCCCAGGGCTGCTGCCAGG - Intronic
907489878 1:54801985-54802007 CAGCTCCCACTCCTCCAGCTTGG + Intergenic
907549459 1:55292156-55292178 CACCTCCCACTTGTATTGCTCGG - Intergenic
907706967 1:56840779-56840801 TACCCCTCACTGCTGATGCTGGG - Intergenic
907862967 1:58371750-58371772 CACCTCCCACTGTTGCTAAAAGG + Intronic
907940181 1:59079986-59080008 CAACTCCCCCTGCCCCTGCTGGG - Intergenic
908651456 1:66337463-66337485 CACCTCTCATTGCTGCCTCTTGG - Intronic
909245327 1:73273964-73273986 TACCTGCCACTGCTTCTGGTTGG - Intergenic
910653751 1:89599217-89599239 TACCTCCCTCTGCTGCTGAGAGG + Intergenic
912383485 1:109260084-109260106 GACTTCTCTCTGCTGCTGCTAGG + Intronic
912421059 1:109542888-109542910 CACCTCCCACTGGAGCCTCTTGG - Exonic
912537797 1:110388564-110388586 CACCTCCCAGTGCTACTTTTGGG + Intronic
912754304 1:112311706-112311728 TACCTCACACAGCTGCTGCAAGG + Intergenic
914918137 1:151830810-151830832 CACCTCCCCTTGCTCCTGCCTGG + Intronic
915041522 1:152971898-152971920 CTGCTGCCGCTGCTGCTGCTGGG - Exonic
915440437 1:155942317-155942339 CACCACCCTCTGCAGCTGGTAGG - Exonic
915763239 1:158336528-158336550 CACCTGCCATTGCTGAGGCTTGG + Intergenic
916788271 1:168102320-168102342 CACCAGCCACTGCTGCTGATGGG - Intronic
919914455 1:202130897-202130919 CACCTCTCCCTCCTGCTGGTTGG + Exonic
921394487 1:214654079-214654101 CTCCTCCTCCTGCTGCTGTTTGG + Intronic
922897228 1:229109655-229109677 GACCTCCCACTTCAGCTGCTAGG + Intergenic
923776296 1:236981647-236981669 CTCCTTCCACTGCTGCTTCTTGG - Intergenic
923833126 1:237580100-237580122 CATCTCACTCTGCTTCTGCTTGG + Intronic
1062788497 10:285345-285367 CGCCTCCCACATGTGCTGCTGGG + Intronic
1062868216 10:875774-875796 TACCTCCCAATGCTGCTGCACGG + Intronic
1062886383 10:1019655-1019677 CAGCTCCCACAGCTCCTCCTGGG + Exonic
1063451315 10:6152205-6152227 CACCTCCCACTGCAGAGCCTGGG + Intronic
1063482528 10:6388438-6388460 AGCCTCCCACTGCTGATCCTGGG - Intergenic
1063565618 10:7170639-7170661 CACCTCCCACCCCTGCTGGGTGG + Intronic
1064060077 10:12129775-12129797 CACTGCCCATGGCTGCTGCTGGG - Exonic
1064905532 10:20341775-20341797 CACTTTCCACTGTTGCAGCTGGG + Intergenic
1064983198 10:21184597-21184619 CCCCTGCTGCTGCTGCTGCTAGG + Intergenic
1065195592 10:23262138-23262160 CATCTGCCAGTGCTGCTGCCTGG - Intergenic
1065964415 10:30759415-30759437 CACCTCCCACAGATGCTGTCAGG + Intergenic
1066964522 10:42250112-42250134 CATCTCCCAGTGCTGCTTGTTGG - Intergenic
1067607714 10:47681135-47681157 CACCTCCACCTGCTACTGCCTGG - Intergenic
1067941400 10:50659971-50659993 GACCTTGCACTGCTGCTGGTAGG - Intergenic
1069081653 10:64094928-64094950 CTTCTCCCACTTCTGCAGCTGGG + Intergenic
1069636754 10:69929742-69929764 AACCTCCCACTGCTGCCTCTGGG - Intronic
1070553448 10:77509985-77510007 ACAATCCCACTGCTGCTGCTTGG + Intronic
1070862638 10:79684933-79684955 GACCTTGCACTGCTGCTGGTAGG - Intergenic
1071623272 10:87142532-87142554 CACCTCCACCTGCTACTGCCTGG - Intronic
1072102315 10:92240282-92240304 CTGCTGCCGCTGCTGCTGCTGGG + Exonic
1072555419 10:96511077-96511099 CACCTCCCACTGTCCCTTCTTGG - Intronic
1072717509 10:97761481-97761503 CACCACCCTCTACTGCTGCAGGG - Intergenic
1073054032 10:100687526-100687548 CCCCTCCCACTTCCTCTGCTTGG - Intergenic
1073331688 10:102674187-102674209 CAGCTCCCACGGCTGCTGGGAGG - Exonic
1073332290 10:102678226-102678248 CCCTTCCCCCTGCTGCTGCCAGG - Intronic
1073464130 10:103684033-103684055 CATCTCCCTCTGCTGCTGGTTGG + Intronic
1073769143 10:106716250-106716272 CACCTGCCACACCTGCTGATTGG - Intronic
1074150979 10:110759599-110759621 CCCCTCCCTCTGCCCCTGCTGGG - Intronic
1074406848 10:113187319-113187341 CTCCTCCCACCCCTGCTGCTGGG + Intergenic
1074941075 10:118236407-118236429 CACCTCCCTCAGGTGCTCCTTGG + Intergenic
1075405602 10:122193725-122193747 CAACTGCGACTGCTGCTGCCAGG + Intronic
1075861934 10:125684428-125684450 TCCCTTGCACTGCTGCTGCTGGG - Intergenic
1075927663 10:126266236-126266258 GCCCTCCCATTGCTGATGCTGGG + Intronic
1076234442 10:128852782-128852804 CACCTCCCATGGTTGCTGCCTGG + Intergenic
1076723519 10:132403049-132403071 CGCTTCCCACGGCTGCTGCAGGG + Intronic
1076747157 10:132520172-132520194 CACCCCCCACTGCAGCCCCTGGG + Intergenic
1076851059 10:133093237-133093259 CACCTCTCACTGCTGCAGAAAGG + Intronic
1077245253 11:1533785-1533807 CCCCTCCCATTTCTCCTGCTCGG - Intergenic
1077509178 11:2946910-2946932 CTCCCCTCACTGCTCCTGCTCGG - Intronic
1078726009 11:13931557-13931579 AACCTCCCATTGCTGTTCCTTGG - Intergenic
1079959791 11:26909079-26909101 CACCTCTCACTGCCTCTTCTGGG + Intergenic
1080100713 11:28456297-28456319 CATGTCCCACTGCTACTGCACGG + Intergenic
1081569240 11:44279331-44279353 CAGTTCCCACTGCTGTTCCTCGG + Intronic
1081717856 11:45263591-45263613 CATGGGCCACTGCTGCTGCTGGG + Intronic
1081729103 11:45355904-45355926 CACCACCCACTCCTGCTGTCTGG + Intergenic
1081851460 11:46277835-46277857 CACCTCCTCCTGCTCCTCCTGGG - Exonic
1083075346 11:60031623-60031645 GAGCTCCCACTCCTGGTGCTTGG - Intergenic
1083582680 11:63835185-63835207 CTACTTCCACTGCTGCTGCCTGG + Intergenic
1084541767 11:69791368-69791390 CAGCTCCCAAGGCTGCTGCCTGG - Intergenic
1086098254 11:83071860-83071882 CTCCACCCCCTGCTGCTGCTGGG - Exonic
1086439623 11:86815139-86815161 CTGTTCCCACGGCTGCTGCTTGG - Intronic
1086472682 11:87132201-87132223 CACCACCCACTGCTGGTTCATGG + Intronic
1089088092 11:115841047-115841069 CACCTGCAATTGCAGCTGCTTGG - Intergenic
1090268768 11:125371264-125371286 CCCCTCTCAGTGCTGCTCCTGGG - Intronic
1090873889 11:130771777-130771799 CACTTCCCACTGCTATGGCTTGG + Intergenic
1091057798 11:132435156-132435178 CACCTGCCACTGCTGATGAGGGG + Intronic
1091184957 11:133638664-133638686 CATCTCCCACTTCCGCTCCTGGG + Intergenic
1091280656 11:134379905-134379927 CACCGCCCACCTCGGCTGCTAGG - Intronic
1091367146 11:135031772-135031794 CAACACTCACTCCTGCTGCTTGG - Intergenic
1092185997 12:6478672-6478694 CACTTCCCCCTGCCGCTGCCTGG - Intergenic
1095296784 12:40535940-40535962 CACCACCCAGTGGTCCTGCTCGG - Intronic
1095832642 12:46604096-46604118 CTGCTGACACTGCTGCTGCTGGG + Intergenic
1095968505 12:47885105-47885127 AACATCCCACTGCTTTTGCTGGG + Intronic
1096123503 12:49103749-49103771 CTCCTCACTCTGCTGGTGCTAGG - Exonic
1096510263 12:52123916-52123938 CCCTTCCCACAGCTGATGCTTGG - Intergenic
1096706473 12:53425206-53425228 CTCCTCCTCCTGCTGCTGCTGGG + Exonic
1097961188 12:65533403-65533425 CTCCTGTCTCTGCTGCTGCTGGG + Intergenic
1100025428 12:90122256-90122278 CAAATGCCACTACTGCTGCTGGG - Intergenic
1101182128 12:102230582-102230604 CACCTCCTTCTCCTGTTGCTGGG + Intergenic
1101874652 12:108590208-108590230 CTCATCCCGCTACTGCTGCTGGG - Exonic
1102002609 12:109566730-109566752 CGCCTCGCACTGCAGATGCTTGG + Intronic
1103434515 12:120914587-120914609 CAGCTCCCATTCCTGCTGCATGG + Intergenic
1103967937 12:124652127-124652149 CACCCCCCGCTGCAGCTGCCTGG + Intergenic
1104365418 12:128172399-128172421 CAGCTTCCAGTGCTGCTGTTGGG - Intergenic
1104464210 12:128977599-128977621 CACCTCCCACTTCACCTGCTGGG + Intronic
1104980934 12:132572835-132572857 CACCTCCCAGGGCTGCTCCCAGG - Intronic
1105472769 13:20706885-20706907 CAGCTGCCACTCCTGCTCCTGGG - Intronic
1106080858 13:26499363-26499385 CACCTCCCAACGCTGCTGGAAGG + Intergenic
1106412142 13:29517962-29517984 CACCTCCCGCTGTTGCTTCTGGG + Intronic
1106723034 13:32455452-32455474 CAGCTGCCACTGCTGCTGCAGGG + Intronic
1106833938 13:33613901-33613923 CTGCTCCCACTGTTGCTGCCTGG - Intergenic
1107373944 13:39782001-39782023 CATCTCCCACTGATTCAGCTGGG - Intronic
1107591332 13:41909787-41909809 CTCCTCCATCTGCTGCTCCTGGG - Intronic
1107798863 13:44084457-44084479 GACCTGCCTCTGTTGCTGCTGGG - Intergenic
1108196155 13:47997555-47997577 TAGCCCCCACTGCTGCTGCTGGG + Intronic
1110283496 13:73722503-73722525 CACCTCCGAATGTAGCTGCTGGG - Intronic
1111149020 13:84223616-84223638 AACCTCCCACAGTTGCTCCTTGG + Intergenic
1111231932 13:85354783-85354805 GCCCTGCCACTGCTGCTGGTGGG + Intergenic
1113349810 13:109518267-109518289 CCACTCCTACTGCTGCTACTTGG - Intergenic
1113491189 13:110693330-110693352 CACCTACTGCTGCTGGTGCTGGG + Intronic
1114631433 14:24161757-24161779 AACCTACCTCTGCTGATGCTCGG + Intronic
1116336693 14:43666005-43666027 GCCCTTCCACTGCTGCTGATGGG + Intergenic
1118497931 14:66327401-66327423 CATCTCCCACAGATTCTGCTAGG + Intergenic
1118842287 14:69522314-69522336 CTCCTCGAACTGCTGCTTCTCGG - Exonic
1119396034 14:74326970-74326992 AGCTTCCCATTGCTGCTGCTTGG - Intronic
1119484653 14:74979711-74979733 CAGCTCCCACTGGTGGTGTTAGG - Intergenic
1119769549 14:77211887-77211909 CATCTCCCACTGCCCCTCCTTGG + Intronic
1120178053 14:81316190-81316212 CACCTGCCATTTCTGTTGCTTGG - Intronic
1121021896 14:90585298-90585320 CGCCTGTCACTGCTGCAGCTAGG - Intronic
1122116489 14:99530138-99530160 CTCCTTACACTGCTGGTGCTAGG + Intronic
1123062315 14:105599844-105599866 CTCCTCCCACTGCCCCTCCTGGG + Intergenic
1123087057 14:105721572-105721594 CTCCTCCCACTGCCCCTCCTGGG + Intergenic
1124271114 15:28281635-28281657 CACATCCTACTGCTGGTGCTGGG - Intronic
1127499263 15:59541514-59541536 GACCTCCCAGTCCTGCTGCCTGG + Intergenic
1127855573 15:62950845-62950867 CACCTCCCAGTGCAGCAGTTGGG - Intergenic
1128215005 15:65928437-65928459 CACAGGCCACTGCTGCTGCCTGG - Exonic
1128286965 15:66445136-66445158 CACCTCCCCCCGCTGCCCCTCGG - Intronic
1128561863 15:68673965-68673987 AAGCTCCTACTGCTGCTTCTGGG - Intronic
1128567987 15:68713903-68713925 CACCTCCCTCTGTTCCTACTAGG + Exonic
1129265656 15:74391908-74391930 CACCGCCTACTGCTGCCTCTGGG + Intergenic
1129384468 15:75188336-75188358 CAGCTCCCAGTGCTGTGGCTGGG - Intergenic
1129697633 15:77749626-77749648 CCACTCCCACGGCTGCTGCGTGG + Intronic
1130381732 15:83377857-83377879 CACCTGCCATTCCTGCTGCATGG + Intergenic
1131350937 15:91699066-91699088 CATCTCCAACTGGTGCTGATGGG + Intergenic
1131629510 15:94161489-94161511 CACCTCCCACTGAGGCACCTGGG + Intergenic
1132143304 15:99412194-99412216 TACCTCCCAGTGCTGCTGGAGGG - Intergenic
1132556457 16:574876-574898 CCCCTCCCACTCCTGCAGCCCGG + Intronic
1132894677 16:2223207-2223229 CCCCGCCCGCGGCTGCTGCTGGG - Intergenic
1133346146 16:5071889-5071911 CTGCTGCCGCTGCTGCTGCTGGG + Exonic
1133613024 16:7450853-7450875 ACCCTCTCACTGCTGATGCTGGG - Intronic
1134795726 16:17034880-17034902 CAGCTCCCACTGTTGCTCTTAGG - Intergenic
1136777216 16:32878468-32878490 AAGCTGCCACTGCTGCTTCTGGG + Intergenic
1136893407 16:33983045-33983067 AAGCTGCCACTGCTGCTTCTGGG - Intergenic
1137235728 16:46615999-46616021 CACCACCCACAGCTCCTGCAGGG + Exonic
1137237586 16:46628132-46628154 CATCTCGCACTCCCGCTGCTGGG + Intergenic
1137753306 16:50882370-50882392 CCCCTGCCACTGCTACTTCTGGG - Intergenic
1138327548 16:56188637-56188659 CATCTCCCACTGCTGATGTTAGG + Intergenic
1139048635 16:63095713-63095735 CATCTCCCATTGCTGCTACCAGG - Intergenic
1139486873 16:67262776-67262798 CACCTGCCACTGCTTCTCCAAGG - Intronic
1141481209 16:84308153-84308175 CACCACCCCCCGCTCCTGCTTGG + Intronic
1141756886 16:85997190-85997212 GACTTCACCCTGCTGCTGCTGGG + Intergenic
1141992457 16:87618326-87618348 CTCCTCCCCCAGCTGCTGCCCGG - Intronic
1142005295 16:87686921-87686943 CACCTCCTGCTGCTGCACCTTGG + Intronic
1142114837 16:88351227-88351249 CCCCTCCCACTGCTGGTCCCGGG + Intergenic
1142171537 16:88625114-88625136 CACCTCACAGGGCTGCTGGTGGG + Intronic
1142292162 16:89198172-89198194 CGCCGCCCCGTGCTGCTGCTGGG - Exonic
1142304820 16:89279312-89279334 CACCTCCCGCGTCTGCTGCGTGG + Exonic
1203079630 16_KI270728v1_random:1140577-1140599 AAGCTGCCACTGCTGCTTCTGGG + Intergenic
1142715446 17:1744811-1744833 CGGCTCCCACTCCTGCAGCTGGG - Intronic
1143095817 17:4477769-4477791 CACCTCCCTGTGCTGCTCCAAGG + Intronic
1143578221 17:7807567-7807589 CACCTCCCGCAGCTTCTCCTGGG - Exonic
1143758910 17:9087197-9087219 CACCTCCCACTCATCCTTCTAGG - Intronic
1143848459 17:9791241-9791263 ATGCTCCCCCTGCTGCTGCTGGG - Exonic
1144532073 17:16049248-16049270 CTTCTGCCACTGCTGCTGCCCGG - Intronic
1145322264 17:21773511-21773533 CACCTCTCCCTGCTGCTCCAAGG - Intergenic
1146171832 17:30640446-30640468 CACATCACACTGCTGCACCTGGG - Intergenic
1146345287 17:32056471-32056493 CACATCACACTGCTGCACCTGGG - Intergenic
1147222586 17:38947151-38947173 CACGTGCCACTGCCGCTGCCTGG - Intronic
1147909152 17:43844480-43844502 CACCTCCCCATGCTTCTGGTGGG + Intergenic
1147948446 17:44093471-44093493 CATCTCCTGCTGCTGCTGCAGGG + Exonic
1149133760 17:53340314-53340336 CATCTGCCACTGCTGGGGCTTGG + Intergenic
1149300062 17:55297019-55297041 CAGCTCCCACTGATGATGCCTGG + Intronic
1149700560 17:58651625-58651647 CGCATCCAACTGCTACTGCTAGG - Intronic
1150210817 17:63440557-63440579 CAGCCCCCACTGTTCCTGCTAGG + Intronic
1150484031 17:65531886-65531908 CACCTCCCACCCCTGCTCCACGG + Intronic
1151961963 17:77410234-77410256 CCCATCCCACTGCTGCTACTGGG + Intronic
1152060253 17:78067872-78067894 CACCTCCTCCTGCAGCTCCTGGG + Exonic
1152511937 17:80795894-80795916 CACTTCCCAGAGCTGCAGCTTGG + Intronic
1152601369 17:81263895-81263917 CAGTGCCCGCTGCTGCTGCTGGG - Intronic
1152670083 17:81598281-81598303 ACCCTCCCTCTGGTGCTGCTGGG + Intronic
1152865533 17:82720438-82720460 ACCCTCCCACGGCTGCTGCACGG - Intronic
1153280735 18:3411849-3411871 CAACTCCCGCCCCTGCTGCTGGG - Intronic
1153801823 18:8677950-8677972 CAGCTCCCACTGCTGCGGTTTGG - Intergenic
1153823963 18:8857217-8857239 CTCCTCCCAGCGCTGCAGCTCGG + Intergenic
1155238731 18:23846190-23846212 CCCGTCCCACAGATGCTGCTGGG + Intronic
1155258695 18:24021086-24021108 CCAGTCCCACTGCTGCTGCTGGG - Intronic
1156298088 18:35810643-35810665 CCCCTCCCCCTGCTGATGCCTGG - Intergenic
1157135223 18:45047619-45047641 CACCCCCTACTCCTGCAGCTGGG - Intronic
1157192292 18:45591655-45591677 AAGCACCCAGTGCTGCTGCTGGG + Intronic
1157815662 18:50728019-50728041 CGCCTCCCAGTGACGCTGCTAGG - Intronic
1158124838 18:54089914-54089936 CACCTCCCTCGCCTGTTGCTAGG - Intergenic
1158561461 18:58517215-58517237 TACCTCCCAGTCCTGCTCCTTGG + Intronic
1160231908 18:77055122-77055144 CAGCGCCGCCTGCTGCTGCTGGG + Intronic
1160476142 18:79190037-79190059 CCCCTCCTGCTGCTGCTGCGGGG - Intronic
1161946734 19:7442005-7442027 CACCTCCCTCTTTTGCTTCTTGG - Exonic
1163641031 19:18462060-18462082 CACCTCCCACTTCTGAGGCTGGG - Intronic
1163732196 19:18955578-18955600 CCCCTCACACTGGTGCTGCTGGG - Intergenic
1164048078 19:21559803-21559825 GGGCTCCTACTGCTGCTGCTTGG + Intergenic
1164617225 19:29674477-29674499 CGCCTCCTCCTGCCGCTGCTGGG - Exonic
1164670502 19:30069639-30069661 CACATGCCACTGATCCTGCTGGG - Intergenic
1164779621 19:30881998-30882020 CACCTTCCACAGCTAATGCTGGG + Intergenic
1164989719 19:32675119-32675141 CACCTCCCTCGTCCGCTGCTGGG + Exonic
1165059136 19:33196199-33196221 CTCCTGCCTCTGCTGCTGCTGGG + Intronic
1165586071 19:36916552-36916574 CACTCCCCACTGCCGCTACTCGG - Intronic
1166375630 19:42325548-42325570 TCCCTCCCACAGCGGCTGCTCGG + Intergenic
1167096997 19:47379888-47379910 CTCCTCCTCCAGCTGCTGCTGGG - Exonic
1167721299 19:51182201-51182223 CACCGCCCGCGGCTGCTGATTGG - Intergenic
1167786930 19:51644757-51644779 CACCTCCCTCGGATGCTTCTCGG - Intronic
1168255217 19:55161251-55161273 CCTGGCCCACTGCTGCTGCTCGG - Intronic
925412898 2:3650281-3650303 GAGCTCCCACTGCTCCTCCTGGG + Intergenic
926128496 2:10286140-10286162 CCCCTCCCGCTGCTGCCCCTGGG - Intergenic
926690656 2:15731086-15731108 CAGCTCCTACAGTTGCTGCTGGG - Intronic
927276096 2:21263667-21263689 CCCCTGCCAATGCTGCTCCTTGG + Intergenic
927651890 2:24918337-24918359 GAGCTCCTCCTGCTGCTGCTGGG + Exonic
929119042 2:38468788-38468810 TTCCTCCTACTTCTGCTGCTTGG + Intergenic
929909067 2:46073493-46073515 CACTTCCCTCAGCTGCTTCTCGG + Intronic
929918412 2:46155062-46155084 CACCTTCCACAGCTCCTGCTGGG - Intronic
931984601 2:67729627-67729649 CTCCTCCCACCGCTGGTGTTTGG - Intergenic
932340015 2:70957677-70957699 TACTTCCCACGGCTGCTGCAGGG - Intronic
932342934 2:70978389-70978411 AACCTCCCAGTCCTGCTGCCCGG - Intronic
932738469 2:74272965-74272987 TAACTCCCACTGATCCTGCTGGG + Intronic
932977780 2:76625105-76625127 CCCCTCCCAGGGCTCCTGCTGGG - Intergenic
933354301 2:81195090-81195112 CACCTCCCGCGTCTGCTGCGTGG + Intergenic
933804608 2:85989038-85989060 CCCCTCCCACTATAGCTGCTGGG + Intergenic
934073693 2:88409263-88409285 CACCTCACAGTGCTGCTGTGAGG - Intergenic
934972953 2:98777885-98777907 CAGCTCCCAGTGCTGATGCAGGG - Intergenic
935179683 2:100678190-100678212 CACCTCACACGGCTGCTGGAAGG + Intergenic
935742878 2:106166345-106166367 CACTTGTCACTGCTGCTGATGGG - Intronic
936078334 2:109415856-109415878 CACCTCTCAGTGCTGCGCCTGGG - Intronic
936418702 2:112343994-112344016 CACCTCACACTCCAGCTGCTTGG - Intergenic
939093089 2:137801377-137801399 CTTCTCTCACTGCTTCTGCTAGG - Intergenic
939914435 2:148021505-148021527 CTGCTGCTACTGCTGCTGCTTGG + Intronic
941625995 2:167830839-167830861 CACCTCACGCTGCTGCTTCCTGG - Intergenic
942387989 2:175461965-175461987 CTCATCCCACTGTTGCTGCTGGG + Intergenic
942763976 2:179432154-179432176 CTGCTGCTACTGCTGCTGCTTGG + Intergenic
942890635 2:180982079-180982101 GAACTGCCACTGCTGGTGCTGGG - Exonic
945902358 2:215553275-215553297 CACCTCCCACTGCACCTCCATGG - Intergenic
946690446 2:222305282-222305304 CCCCGCCCCCAGCTGCTGCTGGG + Intergenic
948164580 2:235851255-235851277 CACCTGGCGCTCCTGCTGCTCGG + Intronic
948174004 2:235928897-235928919 CACCTCCCCCGGCTGCTGTGAGG + Intronic
948667244 2:239544380-239544402 CGCCTCCTCCTGCTGCTGCCTGG + Intergenic
948722816 2:239912194-239912216 CACCCCCCTCTGGTCCTGCTGGG + Intronic
1171206080 20:23282625-23282647 CACCTCCCCCTCCTGTTTCTGGG - Intergenic
1171324938 20:24282887-24282909 GACCTGCCACTGCAGCTGGTGGG - Intergenic
1173207494 20:41006468-41006490 CAGCTTCCACTGCTGCCACTGGG + Intergenic
1173211451 20:41035980-41036002 TTCATCCCACTTCTGCTGCTTGG - Intronic
1173366391 20:42389468-42389490 CACCTCCCAACACTGCTGCAAGG - Intronic
1173476067 20:43360596-43360618 CCACTTCAACTGCTGCTGCTTGG + Intergenic
1174056489 20:47801937-47801959 CTCCTCCCATTGCTGATGCCTGG + Intergenic
1174080381 20:47967217-47967239 CACAGCCCACTGCTGGGGCTGGG + Intergenic
1174137212 20:48388056-48388078 CACAGCCCACTGCTGGGGCTGGG - Intergenic
1175072967 20:56350167-56350189 CACCTCTCAGTGCTGTTGCGTGG - Intergenic
1175140987 20:56860128-56860150 CACCTCACACTGCTGCTCCCTGG + Intergenic
1175200597 20:57274367-57274389 CTCCTCCCACTGGGGTTGCTAGG + Intergenic
1175200980 20:57277536-57277558 CCCCTCCCCCTGCTCCTCCTAGG - Intergenic
1175313164 20:58025681-58025703 CAGCCCCCACTGCTGCTTATGGG - Intergenic
1175452014 20:59077500-59077522 CACCTGCCATTGCTGCCCCTGGG + Intergenic
1175493595 20:59396113-59396135 CTCCTCCTGCAGCTGCTGCTGGG - Intergenic
1175504002 20:59469368-59469390 CACCTTCAGCTGCTGGTGCTGGG - Intergenic
1175878851 20:62244800-62244822 CACTCCCCACAGCTGCTTCTTGG + Intronic
1175983445 20:62752789-62752811 CTCTTCCCACTCCGGCTGCTGGG - Intronic
1176231000 20:64032836-64032858 CACCTCCTCCTGCTGCTCCTGGG - Exonic
1176290862 21:5043908-5043930 CACCTCCCACTGCAGCTGCAGGG - Intergenic
1179866393 21:44219733-44219755 CACCTCCCACTGCAGCTGCAGGG + Intergenic
1180368319 22:11960101-11960123 CACCTCCCAGTTAGGCTGCTCGG - Intergenic
1182132616 22:27868203-27868225 CACCTCCCAGTGTTTCTACTAGG + Intronic
1183338050 22:37262213-37262235 CACCACCATCTGCTGCTGCTGGG - Intergenic
1183572179 22:38661882-38661904 GACCTCTCACTGCTCCTCCTGGG - Intronic
1183762358 22:39833245-39833267 CACCTCCCACTTAAGCTGATAGG + Intronic
1184092621 22:42300461-42300483 CACCTCCCACTTCTGATGGTGGG + Intronic
1184381336 22:44146791-44146813 CAGCTCCCAGGGCTGCTCCTTGG + Intronic
1184593920 22:45503016-45503038 CCGCTTCCGCTGCTGCTGCTCGG + Exonic
1184768061 22:46582295-46582317 CTTCTCCCACTGCAGCTTCTCGG - Intronic
1185085234 22:48737352-48737374 CACCTCCCACTAGGGCAGCTCGG - Intronic
1185386318 22:50532635-50532657 CACCACCCAGTGCCGCCGCTGGG + Intergenic
949501223 3:4681797-4681819 CATGTCCTGCTGCTGCTGCTGGG + Intronic
950254879 3:11496314-11496336 CACCTCCCACTGCTCCTTACAGG - Intronic
951770441 3:26250230-26250252 CACCTGCAGCTGCTGCTGCTCGG + Intergenic
951844684 3:27072806-27072828 CTCCACCCACTGGTTCTGCTAGG + Intergenic
952892060 3:38049932-38049954 CACCTCCCACTTGTGCTTCCAGG + Intronic
953189441 3:40669997-40670019 CACCTGCCACTCCTGCTCCTTGG + Intergenic
953460501 3:43078272-43078294 CACTTCCCACTGCGGCTCCCAGG + Intergenic
954369487 3:50162726-50162748 CACGACACACTGCTGCTGCCTGG + Intronic
958678597 3:97296616-97296638 TCACTGCCACTGCTGCTGCTGGG - Intronic
960845555 3:122001397-122001419 CTCCTCCTCCTGCTGCTGATTGG - Exonic
961246359 3:125457278-125457300 TTCCTCACACTGCTGCTTCTTGG + Exonic
961791304 3:129378570-129378592 CACGTCTCCCTGCTGCAGCTGGG + Intergenic
962384401 3:134921226-134921248 CCCCTCCCACTGTTGCTTTTAGG + Intronic
966207476 3:177419929-177419951 CACCTCCCACGGCAGTAGCTTGG + Intergenic
966886520 3:184380355-184380377 CTCCTCGGGCTGCTGCTGCTCGG + Exonic
968075072 3:195811862-195811884 CTCCTCACACTGCAGCTGCTGGG - Exonic
968500066 4:945756-945778 CACCTCCCGCTGGTGCTGAAGGG + Intronic
968575238 4:1362957-1362979 CACCTCCAACATCTGCTGCTGGG - Intronic
968785802 4:2621574-2621596 GATCTCACTCTGCTGCTGCTTGG + Intronic
969084914 4:4649086-4649108 CAGCACACACTGCTGCTGCCTGG + Intergenic
969203280 4:5622653-5622675 CTCCTCCCCCTCCAGCTGCTCGG + Exonic
969321682 4:6416709-6416731 CAGAGCCCAGTGCTGCTGCTTGG - Intronic
969532677 4:7738540-7738562 CACCTCTCACCGTTGCTGCGGGG + Intronic
969930629 4:10627654-10627676 CTCCTCCTTCTGCTGCTGCAGGG + Intronic
970419382 4:15891100-15891122 CATCTCCCAGTGCTGTTGCATGG + Intergenic
970643250 4:18090677-18090699 CACCTGCCATTGCTGAGGCTCGG + Intergenic
971470852 4:27024964-27024986 CAAGGCCCACTGCTGCTCCTGGG + Intronic
972411240 4:38797019-38797041 GACCTCCCTCTGCAGCTACTTGG - Exonic
972582158 4:40404555-40404577 CCCATCCCTCTCCTGCTGCTTGG + Intergenic
973263979 4:48192845-48192867 CTCCTACCAAGGCTGCTGCTTGG + Intronic
974091767 4:57318492-57318514 CACCTCCCACGGCTACTAGTTGG - Intergenic
974683639 4:65195722-65195744 CCTCACCCACTGCTGCTGCAGGG - Intergenic
975131917 4:70839667-70839689 CGCCGCCTGCTGCTGCTGCTCGG - Exonic
977577484 4:98690638-98690660 CACCTCCCTTTGCCGCTGCTGGG + Intergenic
977947742 4:102933145-102933167 CATCTCCCAGTGCTGCTTGTTGG + Intronic
980009452 4:127579696-127579718 CCCCTCCCAGGGCTCCTGCTTGG + Intergenic
980876221 4:138665055-138665077 CAGCTTCCACTGCTGCCTCTTGG + Intergenic
981348154 4:143699521-143699543 CAGCTCCCTCAGCTCCTGCTGGG + Exonic
982651829 4:158096424-158096446 CATCTCCCACCTCTGCTCCTGGG - Intergenic
985063922 4:186103990-186104012 CACCTCCCAATCCCGGTGCTGGG + Intergenic
985369203 4:189267465-189267487 CTCCTCCAGCTGCTGCTACTGGG - Intergenic
985514269 5:331670-331692 CACCACTCACTCCTGCTGTTTGG - Intronic
986156037 5:5176899-5176921 CAAGTCACACTTCTGCTGCTGGG + Intronic
986169440 5:5303729-5303751 CACCAGCCACTGCAGCTTCTTGG - Exonic
987896838 5:23957365-23957387 CACCTGTCACTCCAGCTGCTGGG + Intronic
987945662 5:24605343-24605365 CCCCTCCCTCTACTGCTGATTGG - Intronic
988727913 5:33942238-33942260 TTCCTCCTGCTGCTGCTGCTTGG - Intergenic
989765228 5:45075264-45075286 TGCCTCCCACTGCTGCAGCTGGG + Intergenic
990376156 5:55173159-55173181 CTCCTCCCACCGCCGCTGCAAGG + Intronic
992988662 5:82260317-82260339 CATCTCACTCTGCTGCTGGTCGG - Intronic
993580251 5:89652499-89652521 CGCAGCACACTGCTGCTGCTTGG - Intergenic
994670173 5:102754819-102754841 CACCTCGCAAGGCTGCTTCTAGG + Intronic
995065575 5:107858187-107858209 CCCTTCCCAAAGCTGCTGCTCGG + Intergenic
996796388 5:127352912-127352934 GGCCTCCTGCTGCTGCTGCTGGG - Intronic
997262751 5:132476867-132476889 CCCCTCCAAGTGCTCCTGCTTGG - Intergenic
998188384 5:140000706-140000728 CACCTCCTCCTGCTGCAGCCAGG + Intronic
998549868 5:143067040-143067062 CCCCTCCCGCTTCTGCTTCTTGG + Intronic
999321212 5:150616208-150616230 CACCTCCCACTGCAGCAGGCTGG - Intronic
1000366934 5:160500503-160500525 AAGATGCCACTGCTGCTGCTTGG - Intergenic
1000609754 5:163360838-163360860 CACTTCTCCTTGCTGCTGCTTGG + Intergenic
1000800958 5:165725658-165725680 CACCTCCCTCAGATGCTGCCTGG + Intergenic
1001545583 5:172568712-172568734 CACATGCCACCCCTGCTGCTGGG - Intergenic
1002848570 6:970492-970514 TACCTCCCAATGTTGTTGCTGGG + Intergenic
1003957672 6:11179254-11179276 CACCTCCAAATGCTGTTGCAAGG - Intergenic
1004066042 6:12245531-12245553 CAGCTTCCACTTCTGCTGATGGG + Intergenic
1004355811 6:14929022-14929044 CACCACCACCTTCTGCTGCTGGG - Intergenic
1004694849 6:18024057-18024079 CACCACCTACTCCTGCTGCATGG - Intergenic
1005117693 6:22356475-22356497 CACCCCCCACCCCTGCTCCTAGG - Intergenic
1005438558 6:25840296-25840318 CATCTCCCTTTGCTTCTGCTTGG - Intronic
1006421495 6:33936826-33936848 CAGCTTCCCTTGCTGCTGCTAGG + Intergenic
1006437623 6:34034392-34034414 CACTCCCCACTGCATCTGCTGGG + Intronic
1006449150 6:34096021-34096043 CCCCTCCTGCTGCTGCTGTTGGG - Intronic
1006477108 6:34263344-34263366 CTCCTTCCGCTGCTGCTTCTTGG + Intergenic
1006614969 6:35319959-35319981 CACCTCCTCCAGCTGCTGCTGGG - Exonic
1006907630 6:37543842-37543864 CACCTGCCACACCTGCTGCAAGG + Intergenic
1006908151 6:37546517-37546539 CACCTCCTAGTGCTGTTGTTAGG - Intergenic
1007072735 6:39048865-39048887 CGCCTTGCGCTGCTGCTGCTCGG + Exonic
1007076706 6:39072978-39073000 CCCATCCCACTGGTGCTGCTGGG - Exonic
1007092454 6:39192696-39192718 CACATCCCCCTCCTGCTGCAGGG + Intronic
1007454701 6:41967624-41967646 CATCTCCCGCAGCAGCTGCTGGG + Intronic
1007464085 6:42039755-42039777 CACCACCCACTCCTGCTTCCGGG + Intronic
1011194100 6:84764452-84764474 CACCTCCTCCTGCTGCTCCGAGG + Exonic
1012258916 6:97065007-97065029 CACCTCCCCCGGCTCCTGCAGGG - Intronic
1012929513 6:105302492-105302514 CTCCTTCCGCGGCTGCTGCTTGG + Intronic
1013638295 6:112049207-112049229 CACCTCCCCGGGCTGCTGCATGG + Intergenic
1014650421 6:124029730-124029752 CACCTCCTGCTGCTGTTGCCTGG - Intronic
1014897631 6:126922658-126922680 CACTTCCCACTGATGGGGCTGGG - Intergenic
1015452644 6:133388931-133388953 CACGTCCTTCTGCTTCTGCTCGG + Intronic
1016798763 6:148146889-148146911 CAGTTCCCGCTGGTGCTGCTAGG + Intergenic
1017155948 6:151322737-151322759 CACCACCCACTCCTGCCACTGGG + Intronic
1017712200 6:157180940-157180962 CACCTCCACATGCTGCTTCTGGG + Intronic
1017750520 6:157486959-157486981 CACCTACCAATGCTGTAGCTGGG - Intronic
1018369713 6:163156495-163156517 CCTCTTCCACTGCTGCTGCCTGG + Intronic
1018571532 6:165216280-165216302 CACTTCCCAATGCTGTTGCATGG + Intergenic
1019430539 7:996993-997015 CAGGACCCACGGCTGCTGCTGGG + Exonic
1019557693 7:1640900-1640922 AGCCTCCCACCGCTGCAGCTCGG + Intergenic
1019618231 7:1976663-1976685 CTCCACCCACTCCTGCTGATTGG + Intronic
1019619786 7:1986301-1986323 CACCAACCTCTGCTGCAGCTTGG + Intronic
1020359747 7:7315444-7315466 CACCTCCCAGTCCTCCTGCCTGG - Intergenic
1022156910 7:27669848-27669870 CACCTCCCAATACTGTTGCATGG + Intergenic
1022172088 7:27840494-27840516 CACCCGCCACCGCTGCTGCCGGG - Intronic
1023286974 7:38630958-38630980 CACCTCCTACTTCTGTTGCCTGG + Intronic
1023760813 7:43463735-43463757 CACCTCCGCCTCCTCCTGCTGGG - Exonic
1023795710 7:43790201-43790223 CACCTCCCAGTGCAGCGGCTGGG - Intronic
1024609080 7:51047696-51047718 CACCTCACACTGCTGCCTGTGGG + Intronic
1025199818 7:56955286-56955308 CACCTGCCACTGCTCCAGCCGGG + Intergenic
1025672127 7:63621646-63621668 CACCTGCCACTGCTCCAGCCGGG - Intergenic
1026006841 7:66606777-66606799 CTCCTTCCGCTGCTGCTTCTTGG + Intergenic
1027239711 7:76318910-76318932 CACCTCCCGCTGCTGGGGCGGGG - Intergenic
1027414927 7:77964485-77964507 CAACTCCCCCTGCGCCTGCTGGG + Intergenic
1029504052 7:100951462-100951484 CTCCTCCCCCTGCTACTGCCTGG - Intronic
1032511360 7:132475180-132475202 TGCCTCCCACTACTGCTCCTAGG - Intronic
1032781201 7:135166538-135166560 GAGCTTCCACTGGTGCTGCTGGG - Exonic
1032858496 7:135857252-135857274 CACCCCTCACTGCTCCTGCCTGG - Intergenic
1034077842 7:148249835-148249857 CACCTTGCACATCTGCTGCTCGG + Intronic
1034196714 7:149254024-149254046 CACATCACACTGATGCAGCTTGG - Exonic
1034256895 7:149729639-149729661 CGCCGTCCACTGCTGCTGCTTGG + Intronic
1034511547 7:151539428-151539450 CACCGCCCACTGCTGTTCTTGGG + Intergenic
1034550351 7:151816511-151816533 CACCTCCCAGGGCTGCTGTTGGG + Intronic
1034818798 7:154197948-154197970 TCCCTCCCACAGCAGCTGCTGGG + Intronic
1035740585 8:1925385-1925407 CACCTTGAACTCCTGCTGCTTGG - Exonic
1035758656 8:2053079-2053101 CATCTCCCCCTGCTACTTCTGGG + Intronic
1036201418 8:6774102-6774124 CAGCTCTCACTGCCGCTGCCCGG - Intergenic
1038531184 8:28319109-28319131 CACCTCACAGGGCTGTTGCTGGG - Intronic
1038865765 8:31437228-31437250 CACCCCCCTCTGCTGCTGTCAGG - Intergenic
1039124590 8:34187221-34187243 CACCACACACTTCAGCTGCTGGG + Intergenic
1039448104 8:37648616-37648638 CACCTCCCACAGCAGCTCCGTGG - Intergenic
1039796780 8:40922627-40922649 CCTCACCCACTGCTGCTGATGGG - Intergenic
1039894763 8:41708925-41708947 CACCTCCACCTGGTTCTGCTTGG + Exonic
1042157135 8:65856516-65856538 CATATCCCACTGCTGCTGCTAGG + Intergenic
1042337197 8:67640808-67640830 GGGCTGCCACTGCTGCTGCTGGG - Intronic
1042460388 8:69058652-69058674 CACCTCTCACATCTCCTGCTGGG - Intergenic
1044449601 8:92319093-92319115 CACCTCCCTCTTCTGATGCAGGG - Intergenic
1045063826 8:98428368-98428390 CTCGTCCCACTTCTCCTGCTCGG - Exonic
1045502573 8:102754494-102754516 CCCCTCTCAGTGCTGCTGCCTGG - Intergenic
1046760124 8:118011984-118012006 CTCCTCCTGCTGCTGCTGCTGGG - Intronic
1048136745 8:131753468-131753490 CACCTCCCACTGCTCCACTTGGG + Intergenic
1048981089 8:139703676-139703698 CCCCTCCCGCTGCACCTGCTCGG - Intergenic
1049007239 8:139863343-139863365 CTCCTCCCTGTGCTGCAGCTGGG - Intronic
1049021563 8:139960800-139960822 CTCCTGCCACTGCAGCTGGTGGG + Intronic
1049728072 8:144160328-144160350 CACTTTCCACTCCGGCTGCTGGG + Intronic
1053024504 9:34718825-34718847 CTCCTCCCACTGCTGGTGGTCGG + Intergenic
1053035914 9:34826634-34826656 CTCCTCCCACTGCTGGTGGTCGG + Intergenic
1057080803 9:92173135-92173157 GACCTTGCACTGCTGCTGGTAGG - Intergenic
1058417001 9:104799824-104799846 CACCTCTGAGAGCTGCTGCTTGG + Exonic
1059104650 9:111501211-111501233 CACCTCCCTCCGCTGCAGCCAGG - Intergenic
1060069702 9:120535206-120535228 CACCTCCAAATGCTGAAGCTAGG + Intronic
1060597678 9:124857957-124857979 CTCCTTCCGCTGCTGCTTCTTGG + Exonic
1060778167 9:126391954-126391976 GACCTGCCACTTCTGCTGCCAGG + Intronic
1060827018 9:126693385-126693407 GACCACCCCCTGCTCCTGCTGGG + Intronic
1061371594 9:130200694-130200716 CCACTGCCACTGCCGCTGCTGGG - Intronic
1061878725 9:133557751-133557773 CACCCCCCACTGCTGCCACTTGG - Intronic
1061950425 9:133932929-133932951 CCCCTCCCAATGCTCCTCCTGGG + Intronic
1062088006 9:134658526-134658548 CACCTCCCCTTCCTGCAGCTAGG + Intronic
1062638214 9:137502592-137502614 AACCTCCCACGGCTCCTCCTCGG - Intronic
1186359179 X:8821593-8821615 CACTCCCCTCTGCTGCTACTTGG + Intergenic
1186917993 X:14244304-14244326 GAACTGCCACTGCTGGTGCTGGG - Intergenic
1188663315 X:32787981-32788003 TACCTCCCACTGCTACTTCAAGG - Intronic
1189267228 X:39726100-39726122 CCTTTCCCCCTGCTGCTGCTGGG + Intergenic
1190233977 X:48602044-48602066 TCCCTCCCTCTGCTGCTGCAGGG + Exonic
1190262782 X:48808236-48808258 CCCCTCTCTCTGCTGCTCCTAGG + Exonic
1190727097 X:53196892-53196914 CACCTGCCGCTGGAGCTGCTGGG + Exonic
1191123692 X:56932260-56932282 CACATCACACCACTGCTGCTGGG - Intergenic
1191865246 X:65698570-65698592 TGCCCCCCACTGCTTCTGCTGGG + Intronic
1192150699 X:68710615-68710637 CACCTCCCTCCCCTGATGCTAGG - Intronic
1192396847 X:70790692-70790714 CACCTCCCAAGGCTCCTGCCTGG + Intronic
1192868136 X:75157744-75157766 CTACTGCCACTGCTACTGCTAGG - Intergenic
1194787737 X:98107021-98107043 CCCCCCACACTGCTGCTGCCAGG + Intergenic
1196326097 X:114404949-114404971 CACCTCCCAACACTGTTGCTTGG - Intergenic
1197348152 X:125349889-125349911 CACACCACACTGCTGCTGATGGG - Intergenic
1199216110 X:145262260-145262282 ACCTTGCCACTGCTGCTGCTAGG - Intergenic
1199336094 X:146620349-146620371 CACCTCCCTCGTCTGCTGCGTGG + Intergenic
1199429734 X:147745640-147745662 CAGCCCCAACTGATGCTGCTAGG - Intergenic
1200102644 X:153695580-153695602 AAGCTGCCACTGCTGCTTCTGGG - Exonic
1200108994 X:153729504-153729526 CGCCGCCCACTTCTGCTGCCGGG + Intronic
1201459146 Y:14203056-14203078 CAGCTCCTTCTGCTCCTGCTAGG + Intergenic