ID: 905304817

View in Genome Browser
Species Human (GRCh38)
Location 1:37010192-37010214
Sequence GAGCAAGGAGTGGCCCGGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 229
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 209}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905304817_905304821 7 Left 905304817 1:37010192-37010214 CCAAGCCGGGCCACTCCTTGCTC 0: 1
1: 0
2: 0
3: 19
4: 209
Right 905304821 1:37010222-37010244 AATTAAGAAAGACAAACTCAAGG 0: 1
1: 0
2: 3
3: 51
4: 707

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905304817 Original CRISPR GAGCAAGGAGTGGCCCGGCT TGG (reversed) Intronic
900407380 1:2498610-2498632 CAGCATGGAGTCGCGCGGCTTGG - Exonic
900589666 1:3454052-3454074 GAGCAAGGAAAGGCCAGGCTCGG + Intergenic
900623469 1:3597756-3597778 GATCAAGGTGTGGGCAGGCTGGG - Intronic
900760539 1:4467369-4467391 GAGAAGGGAGTGGCATGGCTAGG + Intergenic
901809643 1:11760302-11760324 GAGGAAGGAGTGGGATGGCTGGG + Intergenic
902067493 1:13700299-13700321 GGGTAAGGAGTGGCGCGGGTGGG + Intronic
903483435 1:23671206-23671228 CAGCAAGGTGAGGGCCGGCTGGG + Intergenic
903736661 1:25534315-25534337 TGGGAAGGAGAGGCCCGGCTTGG - Intergenic
903844327 1:26268666-26268688 GATCAGGGAGTGGCCAGGCAGGG + Intronic
904591355 1:31617349-31617371 CAGCAAGGAGAGGCGGGGCTGGG + Intergenic
904802277 1:33102020-33102042 GAGCAAGGAGTGGAATGGCTGGG + Intronic
905182244 1:36174776-36174798 GAGGGAGGAGTGGGCAGGCTAGG - Intronic
905205140 1:36339163-36339185 GAGCAGGAAGAGGCCTGGCTGGG + Intergenic
905259196 1:36705708-36705730 GAACAAAGAGTGGCCTGGTTTGG - Intergenic
905304817 1:37010192-37010214 GAGCAAGGAGTGGCCCGGCTTGG - Intronic
907435038 1:54440198-54440220 GAGAGAGGAGTGGCCTGGGTGGG + Intergenic
908040307 1:60105613-60105635 AAGCAAGAAGTGGCCGGGCATGG - Intergenic
908342505 1:63196265-63196287 GATCAAGGAGTGGCAAAGCTTGG + Intergenic
909692399 1:78423463-78423485 GAGCATGGAATGTCCCTGCTGGG - Intronic
910455354 1:87391982-87392004 GAGCAAGAAGAGGCACGGCTTGG + Intergenic
915512242 1:156392694-156392716 GGGCCAGGAGTGCCCCAGCTGGG + Intergenic
915903622 1:159862972-159862994 GAGGAAGGAGAAGCCAGGCTTGG + Intronic
918097807 1:181349101-181349123 GAGCAGGGAGGGGGCGGGCTTGG + Intergenic
920377808 1:205518778-205518800 GAGGAAGGAGGAGCCAGGCTGGG - Intronic
922504340 1:226117963-226117985 AAGCAAGGAGTGTCCTGGCTTGG + Intergenic
923111979 1:230898302-230898324 GAGCAGGGAGTGGCTCTGCCTGG - Intergenic
924386461 1:243502788-243502810 GTGTGAGGAGTGGCCCGCCTGGG + Exonic
1064029618 10:11875532-11875554 GAGCAAGGCGGGGTCGGGCTGGG + Intergenic
1064147291 10:12835700-12835722 GAGCAGGGAGTGGCAGGGATGGG + Intergenic
1064633763 10:17343140-17343162 GAGCAAGAAGAGGACAGGCTGGG - Intronic
1065158489 10:22894757-22894779 GTGCAAGCAGTGGCCCTGGTAGG + Intergenic
1067552756 10:47246899-47246921 GGGCAGGGAGTGTCCAGGCTGGG + Intergenic
1068943974 10:62709894-62709916 GAGCAATGAGTGGCTTGGCATGG + Intergenic
1070191946 10:74119016-74119038 GTGCCGGGAGTGGCCCTGCTGGG - Exonic
1072503777 10:96044037-96044059 GAGCTGGGGGAGGCCCGGCTGGG - Intronic
1072636370 10:97181099-97181121 GAGCAGGGAGAGGCACGGCACGG + Intronic
1072662510 10:97371413-97371435 GAGCAAGGAGTTGTCAGTCTTGG - Intronic
1073094148 10:100969687-100969709 GAGAAAGGCCTGGCCCAGCTTGG - Intronic
1074416267 10:113269571-113269593 GGCCAAGGAGTGGCCTGGCAGGG - Intergenic
1074840286 10:117344675-117344697 TAGCATGGAGTGGCCGGGCGTGG - Intronic
1075420833 10:122299178-122299200 GAGAAAGTAGGGGCCAGGCTGGG + Intronic
1076736636 10:132462028-132462050 GCCCAAGGAGGGGCCCGGCAGGG - Intergenic
1076868245 10:133179901-133179923 GAGCACCGAGTGGCCCTGCCTGG - Intronic
1077145243 11:1041620-1041642 GAGGGAGGAGTGGCCTGGCCAGG - Intergenic
1077307553 11:1874839-1874861 AAACAAGGAGAGGCCCGGCAGGG + Intronic
1077336502 11:2007265-2007287 GGGCAAGGAGGGGCCACGCTAGG - Intergenic
1077476740 11:2794069-2794091 GAGCGAGGGATGGCCCGGCCGGG + Intronic
1084441913 11:69179403-69179425 GACAATGGAGTGGCCTGGCTGGG + Intergenic
1084744018 11:71156110-71156132 GATCAAGGTGTGGCAGGGCTGGG - Intronic
1084965058 11:72740113-72740135 GAGCAAGAAGAGGACAGGCTGGG + Intronic
1088777104 11:113096125-113096147 GAGCAAAGGATGGCCTGGCTTGG + Intronic
1089665279 11:120014108-120014130 GAGCAGCGGGTGGCCCCGCTTGG + Intergenic
1091331079 11:134731344-134731366 GAGCAAGGAGAGGTTTGGCTGGG - Intergenic
1202819486 11_KI270721v1_random:62447-62469 GGGCAAGGAGGGGCCACGCTAGG - Intergenic
1097177669 12:57152670-57152692 GAGGAAAGAGTGGCTGGGCTTGG + Intronic
1101986454 12:109451097-109451119 GAACCAGGAGTGGACCTGCTGGG + Exonic
1102040269 12:109796474-109796496 GAGGAAGGAGGGGCAGGGCTGGG - Intronic
1103473821 12:121203644-121203666 GAGGAGAGACTGGCCCGGCTGGG + Intergenic
1103763959 12:123269144-123269166 CAGCCAGGAGTGGCACAGCTGGG - Intronic
1103945561 12:124524431-124524453 GAGAAAGGAGTGTCCCTCCTGGG + Intronic
1104592030 12:130092452-130092474 GAGCCAGGGGTGGCCCAGCAGGG + Intergenic
1104958389 12:132476856-132476878 GAGGAAGGAGAGGGCAGGCTGGG - Intergenic
1105605945 13:21926664-21926686 GACCAAGGAGTCTCCTGGCTGGG + Intergenic
1105686912 13:22793032-22793054 GAGGAAGAAGCGGCCAGGCTTGG + Intergenic
1107058353 13:36130713-36130735 AAGGAAGGAGTGGCCGGGCCCGG - Intronic
1111920332 13:94403144-94403166 GAGCAGGGAGTGGCCACGCTGGG - Exonic
1112091727 13:96090574-96090596 GAGCAGGGAGCGGGCCGGCCCGG + Intergenic
1113555482 13:111230574-111230596 AAGCCAGGAGTGGCCTTGCTGGG + Intronic
1114092435 14:19302109-19302131 AAGGAAGGCGTGGCCCGGGTGGG - Intergenic
1117772608 14:59150078-59150100 GGGCTAGGAGTGGCCAGGCACGG - Intergenic
1118658441 14:67980152-67980174 GAGGAAGAAGTGGCCAGGCATGG + Intronic
1120186158 14:81395866-81395888 GAGGTAGGAAGGGCCCGGCTTGG - Intronic
1122229416 14:100298208-100298230 GAGCAAGGAAGGGCCCCGCTGGG + Intronic
1122242182 14:100376264-100376286 GAGCGCTGACTGGCCCGGCTGGG - Exonic
1122425790 14:101604634-101604656 GAGAAGGGAGGGGCCCGGGTGGG + Intergenic
1125748535 15:42013314-42013336 GAGCAAGGAGTGCTCCGTGTGGG + Intronic
1127629815 15:60817639-60817661 GAGAAAGGGCTGGCCAGGCTAGG - Intronic
1128570798 15:68731454-68731476 GAGATAGGAGTGGCCCAGCCTGG + Intergenic
1128635506 15:69299639-69299661 GAGCCAGGAGATGCCCAGCTGGG - Intronic
1129257564 15:74342725-74342747 GAGAGAGGAGTGGCCGGGCATGG - Intronic
1129373967 15:75116039-75116061 GAGCAAGGGGTGGCGCTCCTGGG + Intronic
1129441744 15:75586125-75586147 AAGCAAGGAGGGGCCAGGCGCGG - Intergenic
1131220640 15:90581065-90581087 GAGAAAGGAGTGGCCTGCCTGGG + Intronic
1131821872 15:96281992-96282014 GAGCAGGGACTAGCCCAGCTGGG + Intergenic
1132236625 15:100227038-100227060 GAGCCAGGAGAGGCCCAGGTGGG - Intronic
1133117755 16:3587890-3587912 GGGCAAGGACAGGCCGGGCTGGG - Intronic
1137716365 16:50600838-50600860 CAGCAAGGAGTGGGACGGCAGGG - Intronic
1138245881 16:55467019-55467041 GAGAAAGGAGAGGCCCAGATCGG - Intronic
1138360759 16:56425460-56425482 CAGCCAGGAGCGGCCCGGCCCGG - Exonic
1139357123 16:66373025-66373047 GAGCAGGGAGGGGCCACGCTTGG - Intronic
1141590448 16:85065313-85065335 GAGCAAGGAGTGGCCGGTCGGGG - Intronic
1142978312 17:3657927-3657949 GAGCAAGGACGGCCCCGGATAGG - Intronic
1145778934 17:27549331-27549353 GACCAGGGAGTTGCCTGGCTTGG - Intronic
1146669540 17:34727237-34727259 GAGCAGGAAGTTGCCAGGCTGGG + Intergenic
1147265807 17:39233812-39233834 GAGCAGGGACTAGCCAGGCTTGG + Intergenic
1147968303 17:44206064-44206086 GAGCCTGGGGTGGCCAGGCTTGG + Exonic
1148755776 17:49972268-49972290 GATCCAGGAGTGGCCCCGCCGGG + Intronic
1148984846 17:51612330-51612352 GAGCAAGGTGGGCCCTGGCTGGG + Intergenic
1150004709 17:61462569-61462591 GCGCAAGGAGGGGGCTGGCTGGG + Intronic
1152587519 17:81195650-81195672 GAGGCAGGAGTGGACCAGCTCGG + Intronic
1153015540 18:579743-579765 TAAAAAGGAGAGGCCCGGCTTGG + Intergenic
1154324402 18:13379728-13379750 CAGCAAGGAGTGGCTTGGCAAGG + Intronic
1156177630 18:34565527-34565549 GAGGAAGGTGTGGCCTTGCTGGG - Intronic
1156868457 18:41915419-41915441 GAGCAAGGTTTGGCCGGGCGCGG - Intergenic
1157687044 18:49650979-49651001 GGGGTGGGAGTGGCCCGGCTGGG + Intergenic
1158818832 18:61135246-61135268 TAGCAAGGATTGGCCAGGCATGG + Intergenic
1158963355 18:62604153-62604175 GAGCAAGGAGAGGCATAGCTCGG + Intergenic
1159229964 18:65593641-65593663 AAGCAAGGAGAGGCCGGGCACGG - Intergenic
1160754013 19:748360-748382 GAGGAAGGCGTGGCCAGGCCAGG + Intergenic
1163446893 19:17352321-17352343 GACCAAGGGATGGCCCGACTCGG - Exonic
1163615372 19:18324187-18324209 GAAAAAGGAGCGGCCGGGCTCGG - Intergenic
1164534155 19:29072360-29072382 GACCAGGGAGTGGCCAGGCATGG + Intergenic
1164798346 19:31054716-31054738 GAGCAAGGTGAGGCCATGCTGGG + Intergenic
1165386123 19:35511638-35511660 GAGGGAGGAGGGGCCCGTCTTGG - Intronic
1166046390 19:40233227-40233249 GAACCAGGAGTGGCCGGGCTGGG - Exonic
1166103619 19:40586654-40586676 AAGCAAGGAGAGGCCGGGCACGG - Intronic
1167617253 19:50542230-50542252 GAGCGAGGAGTGGACAGGCTGGG + Intronic
926253938 2:11173752-11173774 GAGCAGGGAGTGGCGTGACTTGG - Intronic
928150851 2:28827228-28827250 TAGCAAAGATTGGCCCGGCTCGG - Intronic
932356870 2:71074334-71074356 GATTAAAGAGGGGCCCGGCTAGG + Intronic
933968880 2:87453808-87453830 CAGGAAGGTGTGGCCCTGCTTGG + Intergenic
934769026 2:96896167-96896189 TAGCAGGGAGGGTCCCGGCTGGG - Intronic
935203721 2:100880250-100880272 GACCAAGGAGTGGAACTGCTGGG - Intronic
936324912 2:111496697-111496719 CAGGAAGGTGTGGCCCTGCTTGG - Intergenic
940769470 2:157825037-157825059 GAGAAAGGAGTGGCTGGGCGTGG - Intronic
942764870 2:179443272-179443294 GAGGCAGGAGTGGCGCGGATGGG + Exonic
944055218 2:195515945-195515967 GAGCAGGGAGTGGCGCTGGTTGG - Intergenic
944801264 2:203239530-203239552 GAGAAAGGAGTGGCGCGCCCAGG - Intronic
948205793 2:236162267-236162289 GAGCAGGGAGTGGCCCCCCCAGG - Intergenic
1168752100 20:290118-290140 CAGCAAAGTGTGACCCGGCTGGG + Intronic
1170563457 20:17578668-17578690 GAGCAAGAAGTGGCCGGGCGTGG + Intronic
1171448654 20:25221606-25221628 GAGGAAGGACTGGACCAGCTTGG + Intronic
1171464466 20:25317906-25317928 GAGGAAGGAGGAGCACGGCTAGG - Intronic
1173433987 20:43016278-43016300 GAGCAAGGAAGGGTCCTGCTTGG - Intronic
1174321110 20:49742234-49742256 GAGCAGGGAGGGGGCCAGCTTGG + Intergenic
1174850331 20:53987905-53987927 GAGCAAAGAGTGGCCAAGCGTGG + Intronic
1178641192 21:34345762-34345784 GAGAAAGGAGCTGGCCGGCTCGG + Intergenic
1178695774 21:34792111-34792133 GCGCCAGGCCTGGCCCGGCTGGG - Exonic
1179953267 21:44723691-44723713 GAGCAAGGAAAGGCCCGCGTGGG + Intergenic
1180074554 21:45456038-45456060 GAGCTAGGAATGCCACGGCTGGG - Exonic
1180488293 22:15820457-15820479 AAGGAAGGCGTGGCCCGGGTGGG + Intergenic
1181639864 22:24190800-24190822 GAGCAAAGTGTGGCCTGCCTCGG + Intergenic
1183018232 22:35007297-35007319 GAGCAAGGTGTGACCCTTCTGGG - Intergenic
1183198751 22:36371418-36371440 GATCAAGGTGTGGACAGGCTTGG - Intronic
1183360004 22:37378571-37378593 GAGCTTGGAGTGGCTGGGCTTGG - Intronic
1183725849 22:39589317-39589339 CACCCAGGAGTGGCCCCGCTGGG + Intronic
1184426677 22:44412700-44412722 GAGTAAGCAGTGGACCTGCTCGG - Intergenic
1184674953 22:46036473-46036495 GAGGAAGGTGTGGCCCAGCGAGG + Intergenic
950103819 3:10375757-10375779 AAGCAAGGAGTGGCAGAGCTGGG - Intronic
954678635 3:52329257-52329279 GAGCAGGGAGAGGCTCTGCTGGG + Intronic
954847443 3:53572203-53572225 GGGCTGGGAGTGGCCAGGCTTGG - Intronic
963673466 3:148280608-148280630 GAGCAGGGAGTGGCGCTGGTTGG + Intergenic
964515338 3:157501478-157501500 GAGAAAGGAGTGGCCCTCCAGGG + Intronic
967091016 3:186134841-186134863 GGGCTAGGAGTGGCCCTCCTGGG + Intronic
967319024 3:188177559-188177581 GAGCTGGGAGAGGCCTGGCTAGG + Intronic
968051696 3:195658651-195658673 GTGCGAGGAGTGGCCGGGCTCGG + Intergenic
968104119 3:195989682-195989704 GTGCGAGGAGTGGCCGGGCTCGG - Intergenic
968289374 3:197526759-197526781 GAGACAGGAGTGGCTCGTCTGGG - Intronic
968302421 3:197627272-197627294 GTGCGAGGAGTGGCCGGGCTCGG - Intergenic
968434508 4:577443-577465 GAGGAAGGCGTGGGGCGGCTGGG + Intergenic
968983826 4:3864947-3864969 GAGCAGGAAGAGGCCCGGCCGGG + Intergenic
969221134 4:5759445-5759467 GGGAAATAAGTGGCCCGGCTGGG - Intronic
969880811 4:10172452-10172474 GAGCCAGGAATGACCCGGTTTGG + Intergenic
970399226 4:15701886-15701908 GAGCCAGGATTGGCCGGGCGCGG - Intronic
970885612 4:20984620-20984642 GAACAAGGAGTGGCGTGGCGGGG - Intronic
973740773 4:53917244-53917266 GAGAGTGGAGTGGCCAGGCTTGG - Intronic
975560827 4:75706900-75706922 GGGAAAAGAGTGGCCAGGCTTGG + Intronic
981748643 4:148073295-148073317 GAGCAAGGCCTGCCCAGGCTGGG - Intergenic
985497765 5:218921-218943 GTGCGAGGAGTGGCCGGGCTCGG + Intronic
987397823 5:17442371-17442393 GAGCATGGAGTGGTCATGCTTGG + Intergenic
989750186 5:44883971-44883993 GAGCAAGGGGTGGCGCTCCTTGG + Intergenic
992634927 5:78718240-78718262 GAGCATGAAGTGCTCCGGCTGGG + Intronic
997341847 5:133151365-133151387 GGGCAAGGAGTGGGCCTGCAGGG + Intergenic
997523722 5:134539487-134539509 GAGCCAGGATTGGCCGGGCGCGG - Intronic
997985260 5:138496264-138496286 GAACAAGGATTGGCCAGGCGTGG - Intergenic
999070036 5:148734821-148734843 GAGCAAGGTGTGGGCAGGTTTGG - Intergenic
1001944826 5:175770388-175770410 GAGCAAGCAGGGGCAGGGCTGGG - Intergenic
1002331191 5:178442110-178442132 GAGAAAGCAGGGGCCAGGCTCGG - Intronic
1005805112 6:29467491-29467513 GATCAAGGAGTGGGCAGGATAGG - Intergenic
1006339889 6:33441006-33441028 GGGCAGGGAGTGGCAGGGCTGGG + Intronic
1007144347 6:39612490-39612512 GAGCTAGGATTGACCCAGCTTGG - Intronic
1008798431 6:55336232-55336254 GACAAAGAAGTGGCCCGGCCCGG - Intronic
1010191558 6:73201878-73201900 AGGCAAGGAGTGGCCAGGCGTGG - Intergenic
1011084007 6:83518984-83519006 GACCAAGGAGTGGGAAGGCTTGG - Intronic
1011254418 6:85406054-85406076 GAGCAAGAAGGGCCCAGGCTTGG - Intergenic
1016998420 6:149977337-149977359 GAGCAAGACGTGCCCCAGCTAGG - Intergenic
1018911266 6:168101813-168101835 GCGCAGGGAGCGGCCCGTCTGGG - Intergenic
1019789528 7:3001945-3001967 GTGGAAGGAGTGGCCCAGCATGG - Intronic
1019962658 7:4473761-4473783 GAGAAAGGAGGGGCCGGGCGTGG + Intergenic
1020109800 7:5441710-5441732 GAGGAAGGAGAGGCTGGGCTGGG - Intronic
1022091140 7:27108783-27108805 GTGGAAGGAGGGGCCGGGCTGGG - Intronic
1022529358 7:31057457-31057479 AAGCAAGGAAGGGCCAGGCTGGG - Intronic
1024089005 7:45920540-45920562 GAGCAAGTAGAGGGCCGGCTGGG + Intronic
1024323228 7:48089555-48089577 GAGCAGAGAGCGGCCCGGCGCGG + Intronic
1024358441 7:48443144-48443166 GAGCAAGGTGTGGGCAGGGTTGG - Intronic
1024539299 7:50463107-50463129 CAGCATTGAGTGGCCGGGCTGGG + Intronic
1026099145 7:67370353-67370375 GAACAAGGACTGGCCGGGCATGG + Intergenic
1029192783 7:98783585-98783607 GAGGAAGGAGTGGGCAGGGTGGG + Intergenic
1036155441 8:6338049-6338071 GACCGAGGAGTGGCCGGGCACGG + Intergenic
1036359151 8:8065439-8065461 GAGCCAGGAGCGGCCCGCGTAGG + Intergenic
1036891807 8:12601513-12601535 GAGCCAGGAGCGGCCCGCGTAGG - Intergenic
1037812379 8:22094753-22094775 GAGGAAGGAGTAGCCTGGTTGGG + Intronic
1039475583 8:37837819-37837841 GAGCCAGGAGGGGCCCGGGGAGG + Exonic
1041049996 8:53925068-53925090 GTGCAAGCAGTGGGCCTGCTTGG - Intronic
1041633075 8:60109899-60109921 GAGCAAGATGTGGCCGGGCATGG - Intergenic
1041804468 8:61834920-61834942 GAGCATTGAGTGACCAGGCTTGG + Intergenic
1047773486 8:128049538-128049560 GAGCAAGGAGTGGACCTGGAGGG - Intergenic
1049472749 8:142783635-142783657 GGGCAAGGAGTGACCCACCTTGG + Intergenic
1050325703 9:4495485-4495507 GAGCAGGGAGTGGGCTGGCAAGG + Intronic
1053106304 9:35411753-35411775 TAGAAAGGAGAGGCCCGGCATGG - Intergenic
1053592977 9:39533147-39533169 GAGCAGGGAGAGCCCCCGCTCGG + Intergenic
1053603636 9:39634594-39634616 GAGCAAAGACTGGCCGGGCACGG - Intergenic
1053861519 9:42390954-42390976 GAGCAAAGACTGGCCGGGCACGG - Intergenic
1054249903 9:62707825-62707847 GAGCAAAGACTGGCCAGGCACGG + Intergenic
1054564014 9:66742347-66742369 GAGCAAAGACTGGCCGGGCACGG + Intergenic
1054573329 9:66832130-66832152 GAGCAGGGAGAGCCCCCGCTCGG - Intergenic
1055096987 9:72423872-72423894 GAGCAAGGAGGTGCCCGGCATGG + Intergenic
1057099510 9:92344836-92344858 GAGCAAAGACTGGCCGGGCGCGG - Intronic
1060275006 9:122175822-122175844 GAGCAAGGAGAGGCCGGGCGCGG + Intronic
1060539773 9:124421451-124421473 GAGCAAGGCCTGGGACGGCTGGG + Intergenic
1061489336 9:130936563-130936585 GAGGAAGGCGGGGCCCGGCCTGG + Intronic
1061613488 9:131763813-131763835 GAGCATGGAGTTGGCCGGCCTGG + Intergenic
1061662068 9:132136814-132136836 GAGGAAGGAGGGGCTCAGCTGGG - Intergenic
1186871644 X:13779949-13779971 GTGCTTGGAGTGGCCTGGCTGGG - Exonic
1189306567 X:39991150-39991172 AAGCAAGAAGTGGCCGGGCACGG - Intergenic
1189337726 X:40180540-40180562 CAGCAAGAGGTGGCCAGGCTGGG - Intergenic
1192203937 X:69083672-69083694 GAGCAGGGAGCTGACCGGCTGGG + Intergenic
1197446328 X:126554756-126554778 GAGCAAAGAGTGGCCCAGGGAGG + Intergenic
1201147683 Y:11073802-11073824 GATCAAGGTGTGGCAGGGCTGGG - Intergenic