ID: 905304858

View in Genome Browser
Species Human (GRCh38)
Location 1:37010582-37010604
Sequence GGAGACTGCTGGGGTAATCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 307
Summary {0: 1, 1: 0, 2: 4, 3: 31, 4: 271}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905304858_905304865 20 Left 905304858 1:37010582-37010604 CCAGGATTACCCCAGCAGTCTCC 0: 1
1: 0
2: 4
3: 31
4: 271
Right 905304865 1:37010625-37010647 AATGCTTGTAGAAAGCACCCAGG 0: 1
1: 0
2: 0
3: 9
4: 130
905304858_905304862 -7 Left 905304858 1:37010582-37010604 CCAGGATTACCCCAGCAGTCTCC 0: 1
1: 0
2: 4
3: 31
4: 271
Right 905304862 1:37010598-37010620 AGTCTCCAGTGTGCAGTGTCCGG 0: 1
1: 0
2: 2
3: 24
4: 190

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905304858 Original CRISPR GGAGACTGCTGGGGTAATCC TGG (reversed) Intronic
900323946 1:2098489-2098511 GGAGACTGCTGAGTTACTTCTGG + Intronic
901264633 1:7901230-7901252 GAAGACTACTGCAGTAATCCAGG + Intergenic
903443704 1:23407305-23407327 GGAGGCTGTTGCGGTAATTCAGG - Intronic
904705872 1:32390278-32390300 GGAGGCTGCTGCAATAATCCAGG + Intronic
904753868 1:32757389-32757411 AGAGACTGTTGCAGTAATCCAGG + Intronic
904762276 1:32814327-32814349 GGAGAATGTTACGGTAATCCTGG - Intronic
905304858 1:37010582-37010604 GGAGACTGCTGGGGTAATCCTGG - Intronic
905349170 1:37332642-37332664 AGATACTGCTGGGGCAATCATGG + Intergenic
906297214 1:44656114-44656136 GGAGAGTGCTGGGGTCAGACAGG + Intronic
909342387 1:74546413-74546435 GGACAGTGCTGGGGTAACTCTGG + Intergenic
910342938 1:86208739-86208761 GGAGCCTAGTGGGATAATCCTGG - Intergenic
911031003 1:93488344-93488366 GGAGACTGCTTGGGTATACTGGG - Intronic
911206366 1:95095209-95095231 GAAGACTGCTGGGGTCACACAGG + Intergenic
911395171 1:97297282-97297304 GGAGACTGCCAGGGTTATACAGG - Intronic
913615225 1:120552607-120552629 GGAGGCTGCTGCGGTAGTGCAGG + Intergenic
913685736 1:121230296-121230318 GGAAACTACTGAGATAATCCAGG - Intronic
914037584 1:144017899-144017921 GGAAACTACTGAGATAATCCAGG - Intergenic
914151870 1:145050033-145050055 GGAAACTACTGAGATAATCCAGG + Intronic
914575048 1:148958301-148958323 GGAGGCTGCTGCGGTAGTGCAGG - Intronic
915176369 1:154018646-154018668 GGAGTCTACTGCGGTAATCCAGG - Intronic
915228547 1:154429047-154429069 GGAGAATGCTGCCCTAATCCAGG + Intronic
915900738 1:159845002-159845024 GGACACTGCTGCCGTAATCCAGG + Intronic
915931900 1:160065907-160065929 GGAGGCTGCTGTGGGCATCCAGG + Intronic
916657170 1:166886515-166886537 GGTGACAGCTGGTGTAAACCAGG + Intergenic
917508309 1:175648964-175648986 GGATGCTGCTGAGGTAGTCCAGG - Intronic
917768753 1:178252935-178252957 AGAGGCTGCTACGGTAATCCAGG - Intronic
918340662 1:183565706-183565728 GGTGACAGCTGGGGTCTTCCAGG + Exonic
918441974 1:184576687-184576709 GAAGCCTGCTGCAGTAATCCTGG - Intronic
919610595 1:199741370-199741392 GGAGACTGCTGGAATAATCTAGG - Intergenic
920473057 1:206248853-206248875 GGAAACTACTGAGATAATCCAGG - Intronic
920785276 1:209034978-209035000 GGAGACTGCTGGGGAGCTCTTGG + Intergenic
921430784 1:215063391-215063413 GGAGACTGCTGCAGTCACCCAGG + Intronic
922828756 1:228539763-228539785 AGAGACTCCTGGTGGAATCCAGG - Intergenic
924946401 1:248849765-248849787 GGAGACTGCCGGGTCACTCCTGG - Intergenic
1062968766 10:1629989-1630011 GGTGACTGCTGGGGTGAGCAAGG - Intronic
1063196379 10:3747435-3747457 AGAGGCTGCTGCAGTAATCCCGG + Intergenic
1065167699 10:22997325-22997347 GGAGACTGCCCGGGAAAACCGGG + Intronic
1066156242 10:32681033-32681055 GGAGACTGATGGGGCTCTCCAGG - Intronic
1067742122 10:48903432-48903454 GGAGGCTGTTGCAGTAATCCAGG + Intronic
1067852563 10:49763065-49763087 GGAGGCTGCTGCGATAATCCAGG - Intergenic
1068548503 10:58379910-58379932 GAAGACTGTTGCTGTAATCCAGG - Intergenic
1069677540 10:70259395-70259417 GGAGAATCTTGGGGTAATCTGGG + Intronic
1070656545 10:78275541-78275563 GGAAACTGCTGAGGTCACCCAGG + Intergenic
1072476824 10:95769694-95769716 GGAGACTACTGCAGTAATACAGG + Intronic
1072805497 10:98421612-98421634 GGAGACAGTTGGGGTTATCTTGG - Intronic
1072924951 10:99609025-99609047 GGAGGCTGCTGTGGTAATCCAGG - Intergenic
1073824122 10:107300837-107300859 GGAGACTATTGTAGTAATCCAGG - Intergenic
1074300894 10:112232536-112232558 GGAGACTGGTGCAGGAATCCAGG + Intergenic
1074593716 10:114840557-114840579 GGAAACTGATGGAGTAACCCAGG + Intronic
1074962819 10:118463477-118463499 GGAGCACGCTGGGATAATCCGGG + Intergenic
1074973838 10:118565133-118565155 GGAGGCAGCTGAGGCAATCCTGG + Intergenic
1076349464 10:129805986-129806008 GGTGACTGTTGTGGTCATCCTGG - Intergenic
1076374413 10:129973439-129973461 GGAGATGGCTGGGGTTCTCCCGG + Intergenic
1077961448 11:7080338-7080360 GGAGACTACTGTAGTAATCAAGG - Intergenic
1078002015 11:7504554-7504576 GGAGACTGCTACAGTAGTCCAGG + Intronic
1078344065 11:10527794-10527816 GGAGGCTACTGGAATAATCCTGG + Intronic
1078571779 11:12464821-12464843 GGGGACTACTGGATTAATCCAGG - Intronic
1078577364 11:12513586-12513608 TGAGATTGCTGGGGTTAGCCTGG - Intronic
1082962629 11:58934111-58934133 TGAGTCTGCTGGGATAAGCCTGG + Intronic
1083275087 11:61592398-61592420 GGGGACTGCTGCACTAATCCGGG + Intergenic
1083628627 11:64084749-64084771 GGAGAATGCTGGGGTCACCAAGG - Intronic
1083771109 11:64868063-64868085 GGAGGCTGCTGGGGTAGGGCGGG - Intronic
1084998447 11:73006567-73006589 GGAGACTGTTGCAGTAATCTAGG - Intronic
1087519630 11:99215331-99215353 GGAGGCTGCTGACATAATCCAGG + Intronic
1087709964 11:101536894-101536916 GGAGACTATTGCGGTACTCCAGG + Intronic
1089912598 11:122117129-122117151 GGAGACTGCTTGAGTCATCATGG + Intergenic
1089949762 11:122514744-122514766 AGAGGCTGCTGTAGTAATCCAGG + Intergenic
1091508786 12:1100489-1100511 GGAGACTGTTGGTGTAATCCAGG + Intronic
1091893640 12:4083067-4083089 TGAGGCTGCTGGGGGAACCCTGG - Intergenic
1092483374 12:8880595-8880617 GGAGACTGCTACAGTTATCCAGG + Intronic
1094667546 12:32536357-32536379 GGAGACTCCTGGAATAATCCAGG + Intronic
1095165042 12:38962293-38962315 GGAGTCAGCTGGGCTATTCCTGG + Intergenic
1097019036 12:56007366-56007388 GGAGACTGCTGGGGGAAAATGGG - Intergenic
1097626171 12:62003097-62003119 GGAGACTAATGCAGTAATCCAGG - Intronic
1098090102 12:66892284-66892306 GGAGGCTGCTGTAGTCATCCAGG - Intergenic
1098150350 12:67540017-67540039 GGAGGCTGCTATGATAATCCAGG + Intergenic
1099482641 12:83188184-83188206 GGATGCTGCTGGGGTATTACAGG - Intergenic
1100343535 12:93704558-93704580 GGAGGCTACTGCAGTAATCCAGG - Intronic
1102789113 12:115629491-115629513 GGAGGCTGCCGGAATAATCCAGG + Intergenic
1102956989 12:117065235-117065257 GGAGGCTGTTGGGGTAGCCCAGG + Intronic
1103137094 12:118516933-118516955 GGAGGCTGCTGTGGAAGTCCAGG - Intergenic
1103447704 12:121004917-121004939 GGAGTCTGCTTGGCTATTCCAGG + Intronic
1106397527 13:29395284-29395306 GGAGGCTGTTGGTGTAACCCAGG + Intronic
1107120198 13:36787693-36787715 GGAGACTGTTGCAGTAATCCAGG + Intergenic
1107387383 13:39926559-39926581 GGACACTGCTGGGGATATCCTGG + Intergenic
1107921193 13:45210003-45210025 GGAGGCTACTGCAGTAATCCAGG - Intronic
1108709741 13:53020913-53020935 GGAGACTTCTGAGATAACCCAGG - Intergenic
1109168868 13:59071460-59071482 GGACACTGCTGGGGGAATTAGGG - Intergenic
1109319579 13:60793287-60793309 GGATACTGCTGGGATAATGGAGG + Intergenic
1109498264 13:63204002-63204024 GAAGACTGCTGGGGACAACCTGG + Intergenic
1110005443 13:70260715-70260737 GGAGAAAGCTGGGTTTATCCTGG + Intergenic
1111188860 13:84781641-84781663 GGAGACTATTGCAGTAATCCAGG - Intergenic
1111903573 13:94229746-94229768 AAAGAGTGCTGGGATAATCCAGG + Intronic
1113886856 13:113665622-113665644 GGAGACAGCTGGGGCACACCTGG - Intergenic
1115365306 14:32550871-32550893 GGAGGCTACTGCAGTAATCCAGG - Intronic
1115369400 14:32595106-32595128 GGAAGCTGCTGTGGTAATACAGG - Intronic
1116017289 14:39422353-39422375 GGAGATTGTTGCAGTAATCCAGG - Intronic
1117308992 14:54503476-54503498 GGAGGCTACTGTGGTAACCCCGG + Intergenic
1118128931 14:62940398-62940420 GGAGACTGTTGCAGCAATCCAGG - Intronic
1118758513 14:68863279-68863301 GAATACTGCTGGGATATTCCTGG - Intergenic
1119909123 14:78333874-78333896 GGAGGCTCCTGCCGTAATCCAGG + Intronic
1120758361 14:88265033-88265055 GGAGGCTGCTGGGCTGGTCCAGG - Intronic
1121225491 14:92318909-92318931 GGAGGCTGCTGCAGTGATCCAGG + Intergenic
1121316624 14:92964692-92964714 GGAGGCTGCTGGGGTCAAACAGG + Intronic
1121442695 14:93958737-93958759 GGAGACAGCTGAGGTGAGCCTGG - Intronic
1121816335 14:96931916-96931938 GGAGAGTGCTGCGGAAATGCAGG + Intergenic
1122320374 14:100851803-100851825 GGGGACTGCCGGGGTAAATCTGG + Intergenic
1122373163 14:101240504-101240526 TGAGACTGCTTGGCTAACCCAGG - Intergenic
1124492000 15:30163850-30163872 GGAGGCTACTGTGGTACTCCAGG - Intergenic
1124751537 15:32374467-32374489 GGAGGCTACTGTGGTACTCCAGG + Intergenic
1126928030 15:53612849-53612871 GGAGCCTGCTATGGTCATCCAGG + Intronic
1127636413 15:60874919-60874941 GGAGACTCTTAGGATAATCCAGG + Intronic
1128576917 15:68782695-68782717 TGAACCTGCTGGGGTAAGCCTGG - Intronic
1128624023 15:69180935-69180957 GGAGACTGTTGCAGTAATTCAGG + Intronic
1131052463 15:89357902-89357924 GGAGACTTCTGAAGTCATCCAGG + Intergenic
1131348479 15:91673880-91673902 AGAGACTGCTGCAGCAATCCAGG - Intergenic
1131387382 15:92018618-92018640 TGGGGCTGCTGTGGTAATCCAGG + Intronic
1132181574 15:99757144-99757166 GGACACTGCTGTGGTGACCCTGG - Intergenic
1132536329 16:482915-482937 GGAGACTGCTCGGGCAAGGCGGG - Intronic
1133460933 16:5985590-5985612 GGGGGCTGCTGGGGCAGTCCTGG - Intergenic
1133734533 16:8604108-8604130 GGAGACTCCTGGGGTCGTCCAGG + Intergenic
1135409897 16:22225695-22225717 GGATACTGCTTGGGTAAAACGGG + Exonic
1135662655 16:24310072-24310094 GGAGATTGCTGGGGCCATCCAGG + Intronic
1136101218 16:27997782-27997804 GGACACTGCTTGGGTAATGGGGG - Intronic
1136551516 16:30984863-30984885 GGGCACTGGTGGGGTATTCCTGG - Exonic
1137047888 16:35685544-35685566 AGAGACTCCTGGGGGACTCCAGG - Intergenic
1137737688 16:50737067-50737089 GGAGACTGATGCAGTAACCCAGG - Intergenic
1138773114 16:59688183-59688205 GGTGACTGCTGGTGTCTTCCTGG + Intergenic
1138882562 16:61033215-61033237 GTCTAATGCTGGGGTAATCCAGG - Intergenic
1141126535 16:81404574-81404596 GGAGACTGCTGGGGCCATCAGGG - Intergenic
1144660335 17:17063939-17063961 TGAGACAGCTGGGTTCATCCTGG + Intronic
1145973479 17:28970634-28970656 GGAGGCTGCTGCGGTGATCTAGG - Intronic
1146124121 17:30218660-30218682 GGAGACTGCTTGAGTAATTAAGG - Intronic
1146328723 17:31909848-31909870 GAAGACTACTGGAATAATCCAGG - Intergenic
1146414034 17:32615230-32615252 AGAGACTGTTGGGGGAATCATGG + Intronic
1146943858 17:36861219-36861241 GGAGGCTGGTGGAGTAGTCCAGG + Intergenic
1149084370 17:52696798-52696820 GGAGACCGGTGGGGTAATGGAGG - Intergenic
1149371276 17:55995577-55995599 GGAAACTGATGCAGTAATCCTGG + Intergenic
1152240720 17:79159510-79159532 GGAGAATGCAGGGGTGTTCCAGG - Intronic
1152477280 17:80526494-80526516 GGAATCTGCAGAGGTAATCCAGG - Intergenic
1152581328 17:81166603-81166625 GGAGACAGGTGGGGGAACCCGGG + Intergenic
1156289631 18:35734966-35734988 GGATAATCCTGGGATAATCCAGG - Intergenic
1157310296 18:46547544-46547566 GAAGACTGCTGGGGCCATCTAGG + Intronic
1157688096 18:49659051-49659073 GGGGATTGCTGGGGGCATCCTGG + Intergenic
1160986456 19:1841177-1841199 GGAGACTGTCAGGGCAATCCTGG - Intronic
1161708065 19:5831524-5831546 GGAAACTGCAGGAGGAATCCAGG - Exonic
1165221464 19:34320104-34320126 GGGGGCTGCTGAGGTAACCCTGG + Exonic
1165465474 19:35972229-35972251 GGAGGCTGCTGCAGTAGTCCCGG + Intergenic
1165759371 19:38311665-38311687 AGAGGCTGCTGGGGTGATCCAGG + Intronic
1166521356 19:43482302-43482324 GGAGAGTGCTGTGATAACCCTGG - Intronic
1167088028 19:47324021-47324043 GGAGACTGCTGAGGTCAGTCTGG - Intergenic
1167510595 19:49893595-49893617 GGAGACTGGGGAGGTTATCCAGG + Intronic
1167680819 19:50919541-50919563 GGAGCCCCCTCGGGTAATCCAGG + Intergenic
1168596694 19:57683196-57683218 GGAGACTACTGGGATAGGCCAGG + Intronic
925134676 2:1517995-1518017 GGTGACTGCAGGGGTCATCCTGG - Intronic
925242816 2:2347567-2347589 GGAGAGAGCTGAGGGAATCCCGG - Intergenic
926419384 2:12681900-12681922 GGAGGCTGCTTCAGTAATCCAGG + Intergenic
926889497 2:17627022-17627044 TGAAACTGCTGGGATAGTCCAGG - Intronic
927792081 2:26018199-26018221 GGAGAATGCTGGGATAGTGCAGG + Intergenic
928637500 2:33262761-33262783 GGAGACAGCTGGGGTTGACCAGG - Exonic
928998864 2:37325345-37325367 GGTGACTGCAGGGGTTTTCCCGG + Intergenic
931287721 2:60846706-60846728 GGAGACTACTGCAGTAATCCAGG - Intergenic
933145037 2:78841643-78841665 GGAGACTGCTGCAGTAATCCAGG + Intergenic
933721310 2:85399135-85399157 GGAGCCTGCTGAGATGATCCAGG - Exonic
936592535 2:113817798-113817820 GGAGACTACTGTAATAATCCAGG - Intergenic
936988077 2:118330819-118330841 GGAGGCTGCTGTAGTAATCCAGG - Intergenic
937172777 2:119893172-119893194 AGAGACTGTTGGAGTGATCCAGG + Intronic
938722660 2:134080114-134080136 TGAGACTGCCAGGATAATCCAGG + Intergenic
941502398 2:166296048-166296070 GGAGACTTTTGGAGTAATCATGG + Intronic
941827545 2:169916894-169916916 GGCAACTGCTGGGGTAATTGAGG - Intronic
942230454 2:173856594-173856616 GGAAACTGCTGGTCTAATACAGG - Intergenic
942671007 2:178376494-178376516 TGAGACTGATGGGGTGATCTAGG - Intronic
946842758 2:223835099-223835121 GGGGACTGCTGGGGGTACCCAGG + Intronic
947167230 2:227274802-227274824 GGAGGCTGCTGTTCTAATCCAGG + Intronic
948050500 2:234976209-234976231 GGCTGCTGCTGGGGTAACCCGGG - Intronic
948178479 2:235961973-235961995 GGAGACTGCTGGGGACAGGCTGG + Intronic
948709086 2:239814191-239814213 GGAGACTCCTAGGCTAAACCTGG + Intergenic
1170074471 20:12404575-12404597 GGAGACTGATGGGGTATTAAGGG + Intergenic
1170589222 20:17758502-17758524 GGAGCCTCATGTGGTAATCCAGG + Intergenic
1172112137 20:32553229-32553251 GGAGGCTGCTGCAGTGATCCAGG - Intronic
1173357092 20:42303714-42303736 GGAGACTGTTGAGGTTGTCCAGG + Intronic
1173553481 20:43949312-43949334 GGAGGCTCCTGCGGTCATCCCGG - Intronic
1173558097 20:43982325-43982347 GCAGACAGGTGGGTTAATCCAGG + Intronic
1173560299 20:44000293-44000315 GGAGACTGCTGCAGTCATCCAGG + Intronic
1178664434 21:34534171-34534193 GGAGACAGCTGGGGTAGGCAGGG + Intronic
1179594706 21:42434851-42434873 GCAGACTGCAGGGGAAATTCAGG - Exonic
1182411446 22:30190267-30190289 GGAGGCTGCTGCAGTAATCCAGG - Intergenic
1182675015 22:32032340-32032362 AGAGACTGTTGCAGTAATCCAGG - Intergenic
1184667768 22:45997654-45997676 GGAGCCTGCTGGAGGAAGCCAGG + Intergenic
1184813606 22:46853994-46854016 GGAGACAGCGGGGGAAATCGGGG - Intronic
1185074417 22:48675670-48675692 GGAGACTGCAGAGGGAAGCCGGG - Intronic
949357045 3:3192146-3192168 GGTGACTGCTGGTGTTTTCCTGG - Intergenic
949852236 3:8430899-8430921 GGAGACTGCCTGGGTGATCTGGG + Intergenic
950635574 3:14312004-14312026 GGAGACTGCTGGACTAATGCAGG + Intergenic
951051391 3:18097811-18097833 GGACACACCTGGGATAATCCAGG + Intronic
951923961 3:27886974-27886996 GGAGGCTGCTGCGATTATCCAGG - Intergenic
952044696 3:29304621-29304643 GGAGAGTGCTGCGGTATTGCTGG - Intronic
953406084 3:42660458-42660480 AGAGGCTGCTGGGGTAAGCAGGG + Intronic
954111932 3:48438681-48438703 GGAGGCTCTTGGGATAATCCAGG - Intronic
954578650 3:51691107-51691129 GGAGACTGCTGGGGGAGCCGAGG + Intronic
954796359 3:53163167-53163189 GGACAGTGCTGGGGTAAGCCTGG + Intronic
956722724 3:72132879-72132901 TGAGTCCGCTGGGATAATCCAGG + Intergenic
956748062 3:72325111-72325133 GGAAACTGCTGTGGTAATGCAGG + Intergenic
956894477 3:73645724-73645746 GTAGACTACTCTGGTAATCCTGG - Intergenic
957186386 3:76946806-76946828 GGAGACTGCTGGGTTGCACCTGG + Intronic
957548380 3:81670298-81670320 GGAGACCCCTGGGCTAATTCAGG + Intronic
960364074 3:116749366-116749388 GGAGGCTACTGCAGTAATCCAGG + Intronic
962120654 3:132556870-132556892 AGAGACTACTGGAGTAATCCAGG + Intergenic
962392690 3:134985928-134985950 GGAGCCTGCTGGGAAAACCCTGG + Intronic
962915768 3:139902135-139902157 GGAGGCTGCTGGGGTGATACAGG - Intergenic
962960905 3:140310143-140310165 GGAGACTGCTGTAGTAACCCGGG - Intronic
963119617 3:141764964-141764986 GGAGGCTGCTGCAGTAACCCTGG - Intergenic
967884158 3:194322027-194322049 GGAGGCTGCTGGGGTTGACCAGG + Intergenic
967893933 3:194382251-194382273 GGAGAGGGGTGGGGTAACCCTGG + Intergenic
968029048 3:195467110-195467132 GGAGACTATTGGCATAATCCAGG + Intergenic
968108916 3:196026253-196026275 GGGGACTGCTGGGGAAGGCCAGG + Intergenic
969052664 4:4384504-4384526 AGGGCCTGCTGGGATAATCCAGG - Intronic
971208086 4:24589473-24589495 GGAGACTGGTGGATTGATCCTGG - Intergenic
973631438 4:52824477-52824499 AGAGACTTCTGGGGGTATCCTGG - Intergenic
973698443 4:53513738-53513760 GGAGACTGTTGGGATAATCCAGG - Intronic
973844669 4:54899346-54899368 AGAGCCTGCTGCAGTAATCCAGG - Intergenic
975390674 4:73813549-73813571 GGAAACTGCTGAGTTAATCCAGG + Intergenic
975835317 4:78416842-78416864 GGAGGCCACTGGGTTAATCCTGG + Intronic
976645992 4:87387903-87387925 AGAGACTACTGTGATAATCCAGG - Intronic
979611637 4:122695524-122695546 GGAGTCTGCTGGAGAAATTCTGG + Intergenic
980517282 4:133879084-133879106 GGAGGCTGCTGGAATGATCCAGG - Intergenic
981300873 4:143184960-143184982 GGAGAGTGCTGGGATCAGCCGGG - Exonic
981722089 4:147811982-147812004 GGTGACTGCTGGGGTCTTCATGG + Intronic
983223328 4:165063899-165063921 TGAGACTGCTGTTGTCATCCAGG + Intergenic
983662536 4:170144315-170144337 GGAGACTGCGGGGGGAATGCTGG - Intergenic
984936670 4:184896131-184896153 TGAGACGGCTGGGGAAATCATGG - Intergenic
985470671 5:42460-42482 GGGGACTGCTGGGGAAGGCCAGG + Intergenic
985491571 5:182750-182772 GGAGGCTGCTGGGCTCTTCCTGG - Exonic
985759436 5:1737560-1737582 GGAGACTGCAGCGGGTATCCAGG - Intergenic
986273804 5:6256419-6256441 GGAGACTCTTGGGGAAATTCAGG - Intergenic
986783032 5:11084594-11084616 GGAGATGGCAGGGGTACTCCTGG + Intronic
987150894 5:15038576-15038598 TGGGCCTTCTGGGGTAATCCAGG + Intergenic
987237861 5:15961058-15961080 GGGGACTGCTGGTGTAAGTCTGG - Intergenic
989175790 5:38524424-38524446 GGAGACCACTGGAGCAATCCTGG + Intronic
990023814 5:51160569-51160591 GGAGATTGTTGGAATAATCCTGG + Intergenic
990521773 5:56588132-56588154 GGAGGCAGCTGCAGTAATCCAGG + Intronic
993707194 5:91184423-91184445 AGAGACTTCTGGGGTGTTCCAGG - Intergenic
997714330 5:136030536-136030558 GGAGAATACTGGGGATATCCTGG + Intronic
998599878 5:143574786-143574808 GGAGGCTGTTGGAGTCATCCTGG - Intergenic
1000361741 5:160454018-160454040 GGAGACCAGTGGGGTAATCTTGG - Intergenic
1002094488 5:176823038-176823060 GGAGGCTGCCGTGGTCATCCAGG + Intronic
1003340989 6:5220631-5220653 GGAGGGTGCTGGTGTATTCCGGG + Intronic
1003985050 6:11427096-11427118 GGAGAACGCTGGTGTAGTCCAGG + Intergenic
1005727609 6:28664926-28664948 GGAGGCTACTGTGGTAATCTTGG + Intergenic
1005761725 6:28973710-28973732 GGAGGCTGTTGCAGTAATCCAGG - Intergenic
1006440340 6:34049859-34049881 GGAGGCTGGTGCTGTAATCCAGG - Intronic
1007448182 6:41923083-41923105 GGAGGCTACTGTGATAATCCAGG - Intronic
1007512965 6:42388686-42388708 TGACACTGCTGGGCTAATTCTGG - Intronic
1007528097 6:42514504-42514526 GGAGACTACTGCAATAATCCAGG + Intergenic
1008035847 6:46744491-46744513 GGAAAATCCTGGGGAAATCCTGG + Intergenic
1014715424 6:124859534-124859556 GGAGACTGCTGTGGTGACACAGG + Intergenic
1017847768 6:158274377-158274399 GGAGGCTGCTGCAGTGATCCGGG - Intronic
1018945775 6:168345983-168346005 GGGGACAGCTGGGGGAAGCCGGG + Intergenic
1019144175 6:169966323-169966345 GGAGGCTCCTGGAGTCATCCAGG - Intergenic
1019930332 7:4218599-4218621 GGAGATGACTGGGGTATTCCAGG + Intronic
1020117091 7:5481984-5482006 GGAGCCTGCTGGGGAAGCCCAGG + Intronic
1020149724 7:5672730-5672752 GGAGGCTGCTGTGGTCTTCCTGG + Intronic
1020352924 7:7242601-7242623 GGAGAATGTTGGTGTCATCCAGG - Intronic
1021048542 7:15953816-15953838 GGAGACTACTGGTGTAAGTCTGG + Intergenic
1022146458 7:27546889-27546911 GGAGACTATTGCAGTAATCCAGG - Intronic
1022757713 7:33311258-33311280 GGAGGCTGCTGAGGTGATCCAGG + Intronic
1024493128 7:50009448-50009470 GGAGCCTGCTGGGGTAAGTGGGG - Intronic
1025837142 7:65104794-65104816 GGAGACTACTGAGATAAACCAGG - Intergenic
1025906922 7:65794304-65794326 GGAGACTACTGAGATAAACCAGG - Intergenic
1028165624 7:87535125-87535147 GGAGTCTGTTGCAGTAATCCAGG - Intronic
1028658228 7:93235473-93235495 TGAGGCTACTGTGGTAATCCAGG + Intronic
1034181863 7:149145667-149145689 GGAGAGTGCTGGTGAAATCGTGG - Intronic
1035623842 8:1056371-1056393 GGAGAAGGCTGAGGTAAACCAGG - Intergenic
1036079618 8:5540689-5540711 GGAGAATGCAAGGCTAATCCTGG - Intergenic
1038037141 8:23696161-23696183 GGAGACATCGGGGGTACTCCAGG + Intergenic
1038646535 8:29366459-29366481 GGAGGCTGGTGTGGTATTCCAGG - Intergenic
1040493613 8:47947204-47947226 GGAGACAGCTGGGGAAGTGCTGG - Intronic
1045109075 8:98922095-98922117 GGAAACTGCTGGCGTATTTCTGG + Intronic
1045279602 8:100738550-100738572 GAAGACTGCTGCAGTAATCCTGG + Intergenic
1045878687 8:107012992-107013014 GGAGGCTGCTGCAATAATCCAGG + Intergenic
1046697360 8:117357041-117357063 GGAGCCCACTTGGGTAATCCAGG + Intergenic
1047464389 8:125098544-125098566 GGAGACTGTTGGAGTAATTCAGG + Intronic
1047772396 8:128039786-128039808 GGAGGCTATTGTGGTAATCCAGG + Intergenic
1049786653 8:144454127-144454149 CGAGCCTGCTGGGGTAACCGGGG + Intronic
1050446817 9:5732232-5732254 GGAGACTATTGTGGTAGTCCTGG + Intronic
1056792115 9:89632817-89632839 GGAGACTTCTGGGGCACTCTTGG + Intergenic
1058233531 9:102461372-102461394 GGAGCCTGCTGGGATGATCCAGG - Intergenic
1059078111 9:111216779-111216801 AGAGACTTCTGGAGTCATCCAGG - Intergenic
1059471035 9:114505093-114505115 GGAGACTGCTGCTGGAGTCCGGG + Intronic
1060883721 9:127136173-127136195 AGAGACTCCTTGGGTAACCCTGG - Intronic
1060927954 9:127468357-127468379 GGAGGCTGTCGGGGTCATCCAGG + Intronic
1061974717 9:134062317-134062339 GCAGACTGGTGGGGCTATCCTGG + Intronic
1062205144 9:135332139-135332161 GGGGGCTTCTGGCGTAATCCTGG + Intergenic
1062426320 9:136507805-136507827 GGGGAGGGCTGGGGTAATCAGGG - Intronic
1186527421 X:10261727-10261749 GGATAATGCTGGTGTAATTCTGG + Intergenic
1187110385 X:16292692-16292714 GGAGACTATTGCAGTAATCCAGG + Intergenic
1189095100 X:38130134-38130156 GGAGACTGCTGCGATAATCTTGG - Intronic
1191231765 X:58101584-58101606 AGAGACTCCTGGTGTAATACAGG + Intergenic
1191235648 X:58131704-58131726 GGAGACTTCTGGCATAACCCAGG + Intergenic
1191246375 X:58231558-58231580 AGAGACTGCTGGCCTACTCCAGG + Intergenic
1193322847 X:80144099-80144121 GGAGACTACTGTGGAAATCCGGG + Intergenic
1194049922 X:89055829-89055851 GGACTCTGCTGGGTTAATCTGGG - Intergenic
1194681651 X:96861532-96861554 GGAGACTGCTATTGTAATCAAGG - Intronic
1195920510 X:109978690-109978712 GAAGGCTGTTGGGGTAATCCAGG + Intergenic
1196768121 X:119268119-119268141 GGAGGCTGTTGCAGTAATCCAGG - Intergenic
1197034710 X:121859655-121859677 GGAGCCTGCAAGGGTTATCCAGG + Intergenic
1199000825 X:142634114-142634136 GGAGACGATTGGAGTAATCCAGG + Intergenic