ID: 905305480

View in Genome Browser
Species Human (GRCh38)
Location 1:37015072-37015094
Sequence CTTGATGCAGAGATGGGACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 225
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 211}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905305480_905305485 19 Left 905305480 1:37015072-37015094 CCTGGTCCCATCTCTGCATCAAG 0: 1
1: 0
2: 0
3: 13
4: 211
Right 905305485 1:37015114-37015136 ACTTCTGCCCAGATTCTATCTGG 0: 1
1: 0
2: 0
3: 16
4: 156
905305480_905305486 23 Left 905305480 1:37015072-37015094 CCTGGTCCCATCTCTGCATCAAG 0: 1
1: 0
2: 0
3: 13
4: 211
Right 905305486 1:37015118-37015140 CTGCCCAGATTCTATCTGGTTGG 0: 1
1: 0
2: 0
3: 7
4: 108
905305480_905305483 -6 Left 905305480 1:37015072-37015094 CCTGGTCCCATCTCTGCATCAAG 0: 1
1: 0
2: 0
3: 13
4: 211
Right 905305483 1:37015089-37015111 ATCAAGAGATTCTGAAGCCTAGG 0: 1
1: 0
2: 0
3: 46
4: 904

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905305480 Original CRISPR CTTGATGCAGAGATGGGACC AGG (reversed) Intronic
900721186 1:4176865-4176887 CTTGATCCTGAGCTGGGATCAGG + Intergenic
900929206 1:5725823-5725845 CTTGAAGCACAGATAGGACTTGG + Intergenic
903036492 1:20496213-20496235 CTTGAAGCAGAGGCGGGACATGG + Intergenic
905305480 1:37015072-37015094 CTTGATGCAGAGATGGGACCAGG - Intronic
905525192 1:38632669-38632691 CTTGGTGCAGAGCTGAGTCCAGG + Intergenic
907554826 1:55334749-55334771 CTTGATGCAGATCTGTTACCTGG + Intergenic
912221109 1:107676540-107676562 CTTCAGGCAGAGATGGATCCAGG - Intronic
916516714 1:165525256-165525278 CAGGATGCAGAAATGGGACCTGG - Intergenic
919178952 1:194057360-194057382 CCTGATGCAGTGATCAGACCTGG - Intergenic
920136107 1:203770644-203770666 CTTTATGGAGAGAGGGGACTTGG - Intronic
921632315 1:217450180-217450202 CTTGATGCAGGGTTGGGATAGGG + Intronic
1062863075 10:825260-825282 CCTAGTGCAGAGAGGGGACCTGG - Exonic
1065200003 10:23303831-23303853 CTTGAGGGAGATTTGGGACCTGG + Intronic
1065727498 10:28679863-28679885 CTTGAAGCAGAGAAGGAACTTGG + Intronic
1065741795 10:28803530-28803552 TCTGATGCAGAGAGGGGTCCTGG - Intergenic
1066244955 10:33573777-33573799 CTTGCTGCAGAGGTGGAAACAGG + Intergenic
1067018482 10:42775166-42775188 CCTGATGCAGAGATATGAGCTGG + Intergenic
1067031190 10:42879577-42879599 CCAGATGCAGAGCCGGGACCTGG - Intergenic
1067041445 10:42955305-42955327 CCCTATGCAGGGATGGGACCAGG - Intergenic
1067219341 10:44332585-44332607 ATTCAGGCAGAGAGGGGACCAGG + Intergenic
1067434187 10:46265739-46265761 CCTTGTGCAGAGGTGGGACCAGG - Intergenic
1068673961 10:59750877-59750899 CAGGATGCAGAAATGGGACTAGG + Intergenic
1071363604 10:84876681-84876703 CTAGATGCAGGGAAGTGACCTGG - Intergenic
1072188172 10:93061371-93061393 CTGGATGCTGAGCCGGGACCGGG + Exonic
1073811309 10:107155390-107155412 CCTGATGGGGAGAAGGGACCAGG - Intronic
1076110424 10:127855609-127855631 CTAGCTGAAGAGATGGGTCCTGG - Intergenic
1077160002 11:1108351-1108373 CACGATGCAGACATGGGCCCGGG - Intergenic
1077187283 11:1240969-1240991 CCTGAGGCAGAGAGGGTACCAGG + Exonic
1077252563 11:1567055-1567077 CTTGGGGCAGGGTTGGGACCTGG + Intronic
1077365796 11:2161089-2161111 CCTGCTGCAGAGCTGGGGCCTGG + Exonic
1078094295 11:8287132-8287154 CTGGATGAAGTGATGGGTCCAGG - Intergenic
1079396680 11:20069561-20069583 CCTGATGCACAGCTGTGACCAGG + Intronic
1079448874 11:20581899-20581921 ATTGTTTCAGAGCTGGGACCAGG + Intergenic
1080447121 11:32347562-32347584 CTTGATTAAGAGATGGGTCAGGG + Intergenic
1083057407 11:59835949-59835971 TTAGATGCAGAGGTGGGGCCAGG + Exonic
1083775968 11:64894461-64894483 CTGGGTGCAGAGGTGGGATCTGG + Intergenic
1083922494 11:65788109-65788131 CTTAAAGCAGAGGTGGGATCGGG + Intronic
1086109965 11:83189121-83189143 CTTGTTTCAGAGAAGGGAGCAGG - Intergenic
1087270953 11:96111104-96111126 ATTGATGCAGAGATGGATCAAGG - Intronic
1088036294 11:105320132-105320154 GTTGATCCAGGGATGGGACAGGG + Intergenic
1088921168 11:114260657-114260679 CCTGAGGCAGAGCTGGGCCCTGG + Intronic
1089085639 11:115814863-115814885 CTTGAGGCAGTGATAGGACAGGG - Intergenic
1089454550 11:118618350-118618372 CTTGCTCCAGAGATGAGACAAGG - Intronic
1089628673 11:119769971-119769993 CTTCATGGGGAGGTGGGACCAGG + Intergenic
1090628776 11:128628078-128628100 CTTGACGCACAGATGGGACATGG - Intergenic
1095385594 12:41646114-41646136 CATGATGTGGAGATAGGACCAGG + Intergenic
1097187954 12:57205585-57205607 GTTGTTGCAGAGCTGGGAGCAGG - Exonic
1098397680 12:70039212-70039234 GTTGATGCAGGGATGGGGACTGG - Intergenic
1100853416 12:98737156-98737178 CTGGAGGCAGAGATGGCAGCTGG - Intronic
1102539057 12:113605327-113605349 CTTTTTGCAGAGATGGGGCGGGG + Intergenic
1102705409 12:114876172-114876194 CCTGAGGCAGAGATGGAGCCGGG + Intergenic
1103633525 12:122283149-122283171 CCTGATGCAGATTTGGGAGCCGG - Intronic
1103918632 12:124388472-124388494 CTGGAAGCAGGGGTGGGACCTGG - Intronic
1104160048 12:126169418-126169440 CATGATGCTGACATGGGACACGG + Intergenic
1106206815 13:27605069-27605091 TTTGTTGCAGAGACTGGACCCGG - Intronic
1107540404 13:41384177-41384199 CTTGAAGCTGAGATGGGAAATGG + Intergenic
1110142563 13:72148841-72148863 CTTGAGGGAGAGTTGGGACAAGG - Intergenic
1113167443 13:107458291-107458313 CTTTACTCAGAGAGGGGACCAGG + Intronic
1114032164 14:18587255-18587277 CCTGATGTACATATGGGACCTGG - Intergenic
1114076943 14:19166285-19166307 CCTGATGTACATATGGGACCTGG - Intergenic
1114085217 14:19233283-19233305 CCTGATGTACATATGGGACCTGG + Intergenic
1115116222 14:29883250-29883272 CTTAATGCGGAGGTGGGGCCTGG - Intronic
1118294855 14:64559434-64559456 CCTGATCCAGATATGGGACCTGG + Intronic
1119156664 14:72417836-72417858 CTTGTTACAGATATGGAACCTGG - Intronic
1121826028 14:97010140-97010162 CTTCATGCAGAGATCAAACCAGG - Intergenic
1121911002 14:97792466-97792488 ATTGGTGCAGAGAAGGGAGCAGG - Intergenic
1122087804 14:99319340-99319362 CTTTTTGCAGAGGTGGGAGCGGG - Intergenic
1122149511 14:99717403-99717425 CGCGATGCAGAGCTGGGGCCAGG + Intronic
1122198733 14:100109029-100109051 CTCGATGCTGAGCTGGGGCCTGG - Intronic
1124143197 15:27095857-27095879 CTGCATGCAGAGAAGGGATCAGG - Intronic
1125750076 15:42021905-42021927 CTGAATGCAGGGATGGAACCTGG + Intronic
1127564452 15:60173151-60173173 GTTGATGAAGAGCTGGGCCCTGG - Intergenic
1128007510 15:64257891-64257913 CTTGTTGGATAGATGGGAGCAGG - Intronic
1128548181 15:68581104-68581126 CTTGAAGCAGGGATGGGACAGGG + Intronic
1128729568 15:70011814-70011836 CTGGAAGCAGAGCTGGCACCAGG - Intergenic
1129520649 15:76183940-76183962 CTGGATGGGGAGATGGGCCCTGG - Intronic
1130011767 15:80157874-80157896 CTGGAAGCAGAGATGGCACAAGG + Intronic
1131016974 15:89066025-89066047 ATTGATTCAGAGTTTGGACCAGG + Intergenic
1131682581 15:94739234-94739256 CTTACTGCAGAGATGGGGACTGG + Intergenic
1132157814 15:99508915-99508937 CTGGATGCAGTGATGGGCCCAGG + Intergenic
1137890712 16:52159291-52159313 CTTGTTGCAGAGCTGAGTCCAGG + Intergenic
1140134640 16:72195164-72195186 CTGGGTGCAGCGATGGCACCAGG + Intergenic
1141170415 16:81687244-81687266 GGGGATGCAGAGATGAGACCTGG + Intronic
1141661153 16:85442322-85442344 GCTGATGCTGAGATGGGGCCAGG - Intergenic
1142687648 17:1586948-1586970 CTTGATGCAGTGATGGCCACGGG - Exonic
1143855330 17:9844004-9844026 ACTGATGCAGACAGGGGACCAGG + Intronic
1144886605 17:18467333-18467355 CTTTATGCTGAGATGGGATGAGG + Intergenic
1145145607 17:20476975-20476997 CTTTATGCTGAGATGGGATGAGG - Intergenic
1146810032 17:35895861-35895883 CATGGGGCAGAAATGGGACCAGG + Intergenic
1146845529 17:36179400-36179422 CCTGCTGCAGAGATGGGCCTGGG + Intronic
1146873745 17:36391241-36391263 CCTGCTGCAGAGATGGGCCTGGG + Intronic
1146881103 17:36442331-36442353 CCTGCTGCAGAGATGGGCCTGGG + Intergenic
1147065644 17:37921630-37921652 CCTGCTGCAGAGATGGGCCTGGG - Intergenic
1150305771 17:64084085-64084107 GTTGATCCAGAGAAAGGACCCGG - Intronic
1151544830 17:74786376-74786398 CTTGGTGCACAGATGGGGCAGGG - Intronic
1151712774 17:75816349-75816371 CTTGATGCAGAGGTGGTCCCCGG + Intronic
1151894304 17:76969687-76969709 CTTGGTGCAGAGGGGGCACCAGG - Intergenic
1152380302 17:79938893-79938915 CATGGTGCAGAGGTCGGACCTGG - Exonic
1152499232 17:80697151-80697173 CTTTCTGCAGAGAGGGGACATGG + Intronic
1152712415 17:81879543-81879565 CTGGGTGCAGAGCTGGGACAAGG + Intergenic
1153660041 18:7318009-7318031 CTTGATTCAGGGATGGGATTGGG + Intergenic
1154374023 18:13794023-13794045 CTTGATGAAGAGAGTGGGCCAGG - Intergenic
1158242068 18:55388749-55388771 CTGAAGGCAGAGATGGGACTGGG - Intronic
1159005437 18:63006114-63006136 CATCATGCAGAGATGGTACAAGG - Intergenic
1160283938 18:77521505-77521527 GTTGATGCAGAGCTGGGACAAGG - Intergenic
1161071725 19:2265632-2265654 TTTGCTGCAGAGATGGGGTCTGG + Intronic
1163307063 19:16487181-16487203 ATTGTTGTAGAGATGGGGCCAGG + Intronic
1164282361 19:23780130-23780152 CTTCATACAGAGAGGAGACCTGG - Intronic
1165229427 19:34377653-34377675 CTTTCTCCAGGGATGGGACCTGG + Intronic
1166318527 19:42002528-42002550 CTGGATGCAGAGCTGGGGTCTGG + Intronic
1166782596 19:45350282-45350304 CTGGATGCAGTGTTGGGAACTGG + Exonic
1168634496 19:57985235-57985257 ACTGAGCCAGAGATGGGACCGGG - Intronic
926396664 2:12449868-12449890 CTTCAAGCATAGATGGGAGCAGG - Intergenic
928216430 2:29365346-29365368 CTTGATGAACAGATGGGATTAGG + Intronic
928294742 2:30072993-30073015 CTTTTTGTAGAGATGGGCCCAGG + Intergenic
929032096 2:37658691-37658713 CTTGATGTAGAGATGGAGGCGGG - Intronic
932264502 2:70355688-70355710 TCTCATGCAGAGATGAGACCTGG - Intergenic
932615030 2:73226362-73226384 ATTGAAGCAGAGATGGGAGGTGG + Exonic
934564974 2:95333800-95333822 CTTGAGGCAAAGGTGGGACTTGG + Intronic
936401547 2:112168377-112168399 CTTGAAGCATAGATGGGGCCTGG + Intronic
937111045 2:119367333-119367355 CTTGATGGAGAGATGGGGGAAGG + Intronic
937674307 2:124572489-124572511 CTTAAAGAAGAGATTGGACCTGG + Intronic
938425447 2:131182625-131182647 CTTGACGCAGAAAAGGTACCTGG + Intronic
938722823 2:134081432-134081454 CCAGATGCAGAGATGGAACTGGG - Intergenic
940395517 2:153185977-153185999 CTTGATCCAGAGCTGTGATCAGG + Intergenic
941016261 2:160360584-160360606 CTTGGTGCAGAGCTGGCACTCGG - Intronic
945063459 2:205928250-205928272 CTTGATGGATAGATGAGACTCGG + Intergenic
946420269 2:219560860-219560882 CAGGGTGCAGTGATGGGACCGGG + Intronic
946442264 2:219706763-219706785 CTTGGAGCAGAGATGGTGCCTGG + Intergenic
947534316 2:230931427-230931449 CTTGATGCAGAGCTGGGATTGGG + Intronic
947979930 2:234399920-234399942 CTTAAGGCAGAGCTGGCACCAGG + Intergenic
948122118 2:235538695-235538717 TCTGATGCGGAGATGGGAACGGG - Intronic
948703844 2:239777503-239777525 CTGGATGCACAGCTGAGACCAGG - Intronic
948778248 2:240301150-240301172 GATGATGCAGAGATGGGAAGAGG - Intergenic
1170940962 20:20847832-20847854 ATGGATGCAGGGATGGGAGCCGG + Intergenic
1171404190 20:24898816-24898838 CTTTCAGCAGAGAGGGGACCTGG + Intergenic
1172755936 20:37284322-37284344 CATGGGGCAGAGATGGGCCCAGG - Intergenic
1173801777 20:45898671-45898693 CTTTAAGCAGAGAAGGGGCCAGG - Exonic
1175762545 20:61571394-61571416 CTTGATGCCCAGAGGGTACCTGG + Intronic
1177304442 21:19294824-19294846 CTTGATGCAGAGCTGAGTTCAGG - Intergenic
1178039722 21:28626664-28626686 GTTTATGTAGAGATGGGGCCTGG - Intergenic
1179707622 21:43191351-43191373 CTTGATTTAGAGATGCCACCTGG + Intergenic
1180292755 22:10859910-10859932 CCTGATGTACATATGGGACCTGG - Intergenic
1180456278 22:15514312-15514334 CCTGATGTACATATGGGACCTGG - Intergenic
1180495561 22:15889332-15889354 CCTGATGTACATATGGGACCTGG - Intergenic
1180902553 22:19385341-19385363 CATGATGCAGTAATGGGGCCTGG - Intronic
1181825156 22:25509017-25509039 CTTTTTGTAGAGATGGGATCTGG + Intergenic
1183430316 22:37761874-37761896 CCTGAGGCAGAGAAGGGAGCTGG + Intronic
1184092231 22:42298891-42298913 CTTGAGGCAGGGATGGCTCCTGG - Intronic
1184382887 22:44157206-44157228 CAGGGTGCAGAGCTGGGACCTGG - Intronic
1184449199 22:44572967-44572989 CGCGGTGCAGAGATGGCACCTGG - Intergenic
951921157 3:27855393-27855415 CTTGATGCAGAGCTGAGTTCTGG - Intergenic
952467489 3:33605541-33605563 TCTGATGCAGAACTGGGACCAGG - Intronic
956471096 3:69567456-69567478 CTTGATGCAGACATTGAAACAGG - Intergenic
961797856 3:129422607-129422629 TGTGATGCAAAGATGGGACCTGG - Intronic
963861096 3:150311421-150311443 CTTCATGGAGAGAAGAGACCAGG - Intergenic
966148989 3:176845295-176845317 CATACTGTAGAGATGGGACCTGG - Intergenic
969929147 4:10613300-10613322 CTTGCTGGAAAGATGGGAACAGG + Intronic
969993944 4:11292566-11292588 CTGGCTTCAGAGATGGGACAAGG - Intergenic
977136084 4:93306412-93306434 CTGGAGGCAGAGATGTGACATGG + Intronic
978490374 4:109305280-109305302 CTTGATGCAGAGAGTCTACCAGG - Intergenic
978561499 4:110038661-110038683 CTAGTTTCAGAGCTGGGACCTGG + Intergenic
978722693 4:111930785-111930807 CTTGTTGCAGAAATGAGGCCTGG + Intergenic
979561317 4:122105153-122105175 CCTGTTGCAGAGCTGTGACCTGG - Intergenic
981829062 4:148979434-148979456 CTTGGTGAATAGATGGGGCCTGG - Intergenic
987198025 5:15547042-15547064 CTTGATTCAGAGGTGAGACCTGG + Intronic
988135448 5:27165143-27165165 CTTCACGAAGAGATTGGACCTGG + Intergenic
990820360 5:59832928-59832950 GTTGAAGCAGAGATGGGGGCCGG + Intronic
992693254 5:79259964-79259986 CCTGAGGCAGAGGTGGGCCCAGG - Intronic
992747670 5:79835322-79835344 CTTGAGGCAGAGATGAAATCTGG + Intergenic
993901959 5:93590230-93590252 CTTGAAGCAGAAATGTGACTTGG + Intronic
995113526 5:108454028-108454050 TTTGCTGCAGGGATGGGGCCCGG + Intergenic
995258060 5:110070469-110070491 CTTGATCCAGAGCTGAGTCCAGG + Intergenic
998102440 5:139445484-139445506 CTTGATCCTGAAGTGGGACCTGG + Intergenic
999240856 5:150126615-150126637 CTGGAGGCAGAGATGAGAGCAGG + Intronic
999624036 5:153501430-153501452 GGTGATGCAGTGATGGGAACAGG + Intronic
1001629937 5:173167650-173167672 CTGGATGGAGAGGTGGGAGCAGG + Intergenic
1001926301 5:175639675-175639697 CGAGAGGCAGAGCTGGGACCTGG - Intergenic
1004596177 6:17102009-17102031 CGTCATGCAGACCTGGGACCTGG - Intergenic
1005965684 6:30724903-30724925 CTTGAAGCTGAGATGGGAAATGG - Exonic
1006799827 6:36752765-36752787 CTCCATGCAGAGACAGGACCTGG - Intronic
1007014149 6:38446372-38446394 TCTGATGCAGAGAGGGGTCCCGG + Intronic
1007358023 6:41335109-41335131 CAGGATGCAGAGATGAGGCCAGG + Intergenic
1008795167 6:55294169-55294191 CTGTATGCAAAGATGGGACTCGG - Intergenic
1010992062 6:82490298-82490320 CCTTATGCAGGGAAGGGACCTGG + Intergenic
1011537628 6:88393323-88393345 CTTGATGCAGAGCTGAGTTCAGG - Intergenic
1013714840 6:112946544-112946566 CTAGATGCAAAGCTGAGACCAGG + Intergenic
1014219614 6:118786896-118786918 GGTGATGCAGAGGTGGGCCCAGG - Intergenic
1014440664 6:121470223-121470245 CTTTTTGCAGACGTGGGACCTGG - Intergenic
1016063031 6:139649958-139649980 CTTGATTGACAGCTGGGACCAGG + Intergenic
1017819475 6:158038946-158038968 CTTCCTGCACACATGGGACCAGG + Intronic
1018686123 6:166306725-166306747 CCTCCTGCAGAGCTGGGACCCGG - Exonic
1018834315 6:167471671-167471693 CTTCATGCAGAGGTGGAAGCAGG + Intergenic
1020399942 7:7764571-7764593 CTTAAGGCAGTGATGGGAGCTGG + Intronic
1023909186 7:44541587-44541609 CTGGAGGCACAGATGGGACCAGG + Intergenic
1028265469 7:88718690-88718712 TTTGATACATAGATGTGACCAGG + Intergenic
1028714324 7:93947329-93947351 CTTGAGGTAGAGGTGTGACCAGG + Intergenic
1029435910 7:100563993-100564015 CTCTATGCAGAGATGGGATGGGG - Intronic
1030143588 7:106330437-106330459 ATTCATGCAGAGATGGGAGATGG + Intergenic
1032738230 7:134712366-134712388 ACTGGTGGAGAGATGGGACCCGG + Intergenic
1034450514 7:151134831-151134853 CCAGATGCAGAGATGGGCCTAGG - Intronic
1034911168 7:155000095-155000117 TCTGCTGCAGAGAGGGGACCTGG - Intronic
1043776664 8:84278315-84278337 CTTGATGCAGCTTTGGGACATGG - Intronic
1046638195 8:116696163-116696185 CTGAATCCAGAGATGGGACAGGG + Intronic
1047550905 8:125871260-125871282 CCTGAGGCAGAGATGGGATAGGG + Intergenic
1047649002 8:126899878-126899900 CTTGATGCAGCCTTGGGACATGG + Intergenic
1048329088 8:133460200-133460222 CTTGCTGCAGAGGTAAGACCCGG - Intronic
1049230794 8:141480215-141480237 CTTGAGGCAGGGGTGGGGCCTGG - Intergenic
1049418571 8:142506609-142506631 CTGTTTGCAGAGATGGGAACAGG + Intronic
1050361115 9:4831945-4831967 TTAGAAGCAGAGCTGGGACCAGG + Intronic
1050694884 9:8267657-8267679 GTTGATGTAGAGTTGGGTCCAGG + Intergenic
1052276670 9:26684474-26684496 CTTGAGGCAGAATTGGGACTAGG - Intergenic
1054878368 9:70120236-70120258 TGTGATGCAGAGATGGAGCCTGG - Intronic
1056717523 9:89044919-89044941 ATTGAGGCAGAGGTGGCACCAGG - Intronic
1057825219 9:98368017-98368039 CTTCATGCACAGAGGGGATCAGG - Intronic
1059400953 9:114070588-114070610 CCTGAGGCAGAGCTGGGCCCAGG + Intronic
1060060365 9:120454256-120454278 CTGGATGTAGAAATGGGGCCAGG - Intronic
1060719792 9:125969281-125969303 CTTGATGCAGAAAAGGTACCTGG - Intergenic
1061042023 9:128145882-128145904 CTTCATGCATGGATGAGACCTGG + Intergenic
1186898753 X:14031479-14031501 CTTGAGGTAGAGATTGCACCAGG - Intergenic
1190337602 X:49271630-49271652 GTTGAGGCAGTGATGGCACCTGG + Intronic
1192897826 X:75462397-75462419 CTTGATCCAGAGATGTGTTCGGG - Intronic
1193608908 X:83604514-83604536 CTTAAGGCTGAGTTGGGACCAGG + Intergenic
1200655011 Y:5890384-5890406 CTTGATGCAATGGTGGGACAGGG - Intergenic
1200765509 Y:7077535-7077557 CCTGAAGCAGAGACTGGACCAGG + Intronic