ID: 905306466

View in Genome Browser
Species Human (GRCh38)
Location 1:37022288-37022310
Sequence TATTAACGACAGCACAGCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 131
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 122}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905306463_905306466 4 Left 905306463 1:37022261-37022283 CCTCACAGCTGTCCTGAGTGCTC 0: 1
1: 0
2: 1
3: 33
4: 270
Right 905306466 1:37022288-37022310 TATTAACGACAGCACAGCAGAGG 0: 1
1: 0
2: 0
3: 8
4: 122
905306462_905306466 15 Left 905306462 1:37022250-37022272 CCACATTTCTGCCTCACAGCTGT 0: 1
1: 0
2: 5
3: 26
4: 405
Right 905306466 1:37022288-37022310 TATTAACGACAGCACAGCAGAGG 0: 1
1: 0
2: 0
3: 8
4: 122
905306461_905306466 19 Left 905306461 1:37022246-37022268 CCAGCCACATTTCTGCCTCACAG 0: 1
1: 0
2: 4
3: 44
4: 466
Right 905306466 1:37022288-37022310 TATTAACGACAGCACAGCAGAGG 0: 1
1: 0
2: 0
3: 8
4: 122
905306460_905306466 20 Left 905306460 1:37022245-37022267 CCCAGCCACATTTCTGCCTCACA 0: 1
1: 0
2: 2
3: 87
4: 412
Right 905306466 1:37022288-37022310 TATTAACGACAGCACAGCAGAGG 0: 1
1: 0
2: 0
3: 8
4: 122
905306464_905306466 -8 Left 905306464 1:37022273-37022295 CCTGAGTGCTCAGCCTATTAACG 0: 1
1: 0
2: 0
3: 4
4: 59
Right 905306466 1:37022288-37022310 TATTAACGACAGCACAGCAGAGG 0: 1
1: 0
2: 0
3: 8
4: 122

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905306466 Original CRISPR TATTAACGACAGCACAGCAG AGG Intronic
900202329 1:1415119-1415141 TATTAAAGTCACCACAGCATGGG + Intergenic
905306466 1:37022288-37022310 TATTAACGACAGCACAGCAGAGG + Intronic
910420831 1:87060571-87060593 TATAAACCACAACACAGCATGGG + Intronic
911650606 1:100383672-100383694 TATTAAGGAGATCACAGCACAGG - Intronic
911675091 1:100649352-100649374 TCTTAAAGACAGCATATCAGTGG - Intergenic
911992614 1:104720978-104721000 TATTCATAACAGCACAGAAGTGG + Intergenic
915108493 1:153548676-153548698 AAATAACAACAGGACAGCAGGGG - Intronic
917115974 1:171603898-171603920 TATTAAAGTCACCACAGCATGGG - Intergenic
919718290 1:200803677-200803699 AAATAACCACAGCACAGTAGTGG + Intronic
922474558 1:225898338-225898360 TGTTAACGAGAGCACTGTAGGGG + Intronic
922680599 1:227592268-227592290 TATTAAAGTCACCACAGCATGGG + Intronic
923195239 1:231660384-231660406 TCTTGAAGACAGCACACCAGTGG + Intronic
924001733 1:239561142-239561164 GATTAAGGACAGCACAAGAGTGG - Intronic
924255564 1:242179481-242179503 TCTTCACAGCAGCACAGCAGTGG - Intronic
924331930 1:242948385-242948407 TCTTAAAGACAGCATACCAGTGG - Intergenic
1068675635 10:59766833-59766855 TATTAAAGTCACCACAGCATGGG + Intergenic
1068675795 10:59768046-59768068 TATTAAAGTCACCACAGCATGGG - Intergenic
1074282102 10:112062373-112062395 TATTTAAGACAGGACAGGAGGGG + Intergenic
1077993935 11:7436803-7436825 TAGTAACAACAGCACAGCTGAGG - Intronic
1080383336 11:31796400-31796422 GATTAATGATAGCAGAGCAGAGG - Intronic
1080386885 11:31815696-31815718 TATTAGCGACAGGAGAACAGAGG + Intronic
1083509298 11:63192566-63192588 TCTTAAAGACAGCACACCAATGG - Intronic
1085998901 11:81955065-81955087 TATTAAAGTCACCACAGCATGGG - Intergenic
1086109814 11:83187652-83187674 TATCAACAATAGCACAGGAGGGG + Intergenic
1087684670 11:101249396-101249418 TATTAAAGTCACCACAGCATGGG - Intergenic
1088790660 11:113223544-113223566 CCTTAACGACAACAAAGCAGGGG - Intronic
1091814357 12:3425245-3425267 TATTAAAGTCACCACAGCATGGG + Intronic
1099181527 12:79476006-79476028 TATTAAGGACAGCATCACAGAGG - Intergenic
1102805401 12:115775261-115775283 TATTATAAACAACACAGCAGTGG + Intergenic
1106524462 13:30527691-30527713 TAATAACTTCAGCACAGCATAGG - Intronic
1106751241 13:32770539-32770561 TGTCAAGGAGAGCACAGCAGAGG + Exonic
1108065732 13:46575918-46575940 GATTAACGGCAGCACAGGATTGG + Intronic
1109759342 13:66806728-66806750 CATTAACTACAGCACAGTAGGGG - Intronic
1110301500 13:73934352-73934374 TAGTAACGACAGCACAGGACAGG - Intronic
1110653559 13:77971300-77971322 TATTAAAGTCACCACAGCATGGG + Intergenic
1111388033 13:87554859-87554881 TATTCAAGACATCACAGTAGGGG - Intergenic
1113784207 13:112993970-112993992 TTTTAAAGACAGCAGAGGAGGGG + Intronic
1116518565 14:45825919-45825941 TATTAACCACATCACAAGAGGGG - Intergenic
1116834397 14:49755991-49756013 TATTAAAGACAGCATAGTACTGG - Intergenic
1117030026 14:51659057-51659079 TATTGAAGACAGCATAGAAGAGG + Intronic
1117498942 14:56332682-56332704 TTTTAAGGACAGCAGAGCAGAGG - Intergenic
1121243102 14:92443776-92443798 CCTTAACTACAGCCCAGCAGAGG - Intronic
1122342854 14:101039611-101039633 AATTAAAGACAGCACAGGATAGG - Intergenic
1139837822 16:69853812-69853834 CATGAATGACAGCACAGTAGAGG - Intronic
1141049055 16:80744327-80744349 TATTAACCATAGCACAGCTCTGG + Intronic
1143237508 17:5415707-5415729 TATTGCTGACAACACAGCAGAGG - Intronic
1146546374 17:33742265-33742287 TAATGACCACAGCACAGTAGGGG - Intronic
1147446245 17:40476967-40476989 TATTTAGGGCAGCTCAGCAGGGG - Exonic
1151652748 17:75480319-75480341 GATTAAAGACAGCACAGTAGAGG - Intronic
1153082614 18:1246436-1246458 TATTATCAACTGCACACCAGGGG - Intergenic
1153199905 18:2637421-2637443 TATGTACCACAGGACAGCAGGGG + Intergenic
1154013985 18:10600267-10600289 TATTAAAGTCACCACAGCATGGG + Intergenic
1158474858 18:57770789-57770811 TGTTAAGGACAGAACAGCAAAGG + Intronic
1158544584 18:58385417-58385439 CATCCACGACAGCAGAGCAGAGG - Intronic
1166548400 19:43648633-43648655 TAATAACAACAACACAACAGCGG + Exonic
1168576684 19:57517461-57517483 TACTGAGGACAACACAGCAGAGG - Intronic
925832038 2:7905135-7905157 TACTAACAACAGCTCAGCTGAGG - Intergenic
928162035 2:28936880-28936902 TATTAACAACAGCACTTCAGAGG - Intronic
929632105 2:43473924-43473946 TACAACTGACAGCACAGCAGAGG + Intronic
935268781 2:101416072-101416094 TGTGAATGACTGCACAGCAGTGG + Intronic
937079224 2:119128398-119128420 TATTAAAGTCAGCACAGCTCCGG - Intergenic
940633601 2:156269757-156269779 TATTAAAGCTAGCACAGCTGAGG - Intergenic
941683929 2:168428406-168428428 CACTAACGGCAGCAGAGCAGTGG + Intergenic
943077429 2:183212327-183212349 TATTAAAGACAACACAACTGTGG - Intergenic
943516632 2:188896277-188896299 CATTAACGATGGCACACCAGAGG + Intergenic
944853791 2:203746903-203746925 TATAAATCACAGAACAGCAGAGG + Intergenic
945043506 2:205762409-205762431 GATTAACAACAGCAAAGCAGTGG + Intronic
1169868433 20:10225576-10225598 TATCAACAACAGCAAAGAAGAGG - Intronic
1170520231 20:17177635-17177657 TGTGAAGGACAACACAGCAGGGG + Intergenic
1178919201 21:36727636-36727658 TATTCCCGACTGCACAGCTGAGG - Intronic
1184504806 22:44894233-44894255 AATTAAGGATATCACAGCAGAGG + Intronic
951655385 3:25001636-25001658 TCTTATCAGCAGCACAGCAGTGG - Intergenic
953774231 3:45801794-45801816 TCTTCATGACAGCACAGCACTGG - Intergenic
956597266 3:70981388-70981410 TATTAGAGACAGCCCAGCAGTGG - Intronic
957999752 3:87736455-87736477 TATTAAAGTCACCACAGCATAGG + Intergenic
959519981 3:107314651-107314673 TCTTAAAGACAGCACACCACTGG + Intergenic
959731135 3:109603947-109603969 TATTAACGAAAATCCAGCAGTGG + Intergenic
959883309 3:111471786-111471808 TGTTAAATACAGCACACCAGTGG + Intronic
960673985 3:120177261-120177283 TATTCAGGTCAGAACAGCAGCGG + Intronic
962096592 3:132298966-132298988 TATTAAAGTCACCACAGCATGGG + Intergenic
964889372 3:161518234-161518256 TAGGAACAACATCACAGCAGGGG + Intergenic
966152818 3:176883571-176883593 TATTAACGATAGCAAAGATGTGG + Intergenic
971909513 4:32777388-32777410 TATTCACTAGAGCTCAGCAGAGG + Intergenic
972275070 4:37549539-37549561 TATTAAAGTCACCACAGCATGGG - Intronic
976262083 4:83155328-83155350 TATTGAAGGCAGCAAAGCAGAGG - Intergenic
976849461 4:89528763-89528785 CACAAACCACAGCACAGCAGAGG - Intergenic
979052606 4:115953605-115953627 TATTAAAGTCACCACAGCATGGG - Intergenic
980637131 4:135521277-135521299 TATTAAGGAAAGCAAAGCTGTGG + Intergenic
982662612 4:158225075-158225097 TATTAAAGTCACCACAGCATGGG + Intronic
988133471 5:27137187-27137209 TATTACTGACAGGCCAGCAGTGG + Intergenic
995867574 5:116707797-116707819 TATTAAAGTCACCACAGCATGGG - Intergenic
999722066 5:154405654-154405676 TATCAACAACAGCTCTGCAGAGG - Intronic
999887798 5:155942486-155942508 TAGAAAGGACAGCACAGTAGTGG + Intronic
1000560206 5:162777722-162777744 TATCAGCCACATCACAGCAGAGG + Intergenic
1000995176 5:167951254-167951276 TCTTAAAGCCAGGACAGCAGGGG + Intronic
1002056595 5:176601387-176601409 GATGAGAGACAGCACAGCAGAGG + Intronic
1002939352 6:1702614-1702636 TATTAATGCCACCACAGCTGGGG - Intronic
1003136683 6:3439762-3439784 TATTCAGGCCAGGACAGCAGGGG + Intronic
1004502240 6:16219373-16219395 TAACAACCACAGCCCAGCAGGGG + Intergenic
1006032022 6:31183339-31183361 TATTAAAGTCACCACAGCATGGG + Intergenic
1006570765 6:35002024-35002046 TATTAAAGTCACCACAGCACAGG - Intronic
1008351355 6:50494745-50494767 TACTAAAGCCAGCAGAGCAGAGG + Intergenic
1012375219 6:98554120-98554142 TGTCAAGGACAGCACAGGAGAGG + Intergenic
1015172080 6:130265051-130265073 TATTAAAGTCACCACAGCATGGG - Intronic
1016045976 6:139480971-139480993 TGTTCACAACAGCACAGCGGTGG - Intergenic
1022894459 7:34735438-34735460 TATTAAGGTCAGCAAAACAGAGG - Intronic
1022898890 7:34782007-34782029 TATTACCAACATTACAGCAGGGG + Intronic
1023156253 7:37255602-37255624 TGGTAAAGACAGCAAAGCAGGGG - Intronic
1024797229 7:53035339-53035361 TATGAACGACATCACAAGAGGGG + Intergenic
1028108263 7:86906139-86906161 TATTTACTACAGCACATCTGGGG - Intronic
1028431721 7:90755182-90755204 TATTCACGATAGCAAAGCTGTGG + Intronic
1031376215 7:121029128-121029150 TATTTACAACAGCAAAACAGTGG - Intronic
1033555017 7:142481752-142481774 TATTGGAGACAGGACAGCAGAGG - Intergenic
1035949393 8:4003042-4003064 TATTTGCAACAACACAGCAGGGG + Intronic
1037421920 8:18711366-18711388 TCTTGAAGACAGCACAGCAATGG - Intronic
1039357861 8:36841162-36841184 CATCAGAGACAGCACAGCAGAGG - Intronic
1041615513 8:59901446-59901468 TCTTAAAGACAGCATAACAGTGG - Intergenic
1043656770 8:82676537-82676559 TCTTAAAGACAGCATAGCAATGG - Intergenic
1048681652 8:136849224-136849246 TATTCACCACAGCAAAGCCGTGG + Intergenic
1051232255 9:14965867-14965889 TAGAAACGATACCACAGCAGGGG + Intergenic
1055704454 9:78982228-78982250 TAATAATGACAACATAGCAGAGG - Intergenic
1058915024 9:109557317-109557339 AATTAGCCACAGCACAGCATGGG + Intergenic
1060330664 9:122666312-122666334 CATTACCGACACAACAGCAGGGG + Intergenic
1186558566 X:10586644-10586666 TATTAAAGTCACCACAGCATGGG + Intronic
1188738607 X:33749300-33749322 TCTTAACGACAGCATACCATTGG + Intergenic
1195477265 X:105301462-105301484 TAGTATTGACAGCACAACAGGGG - Intronic
1196869567 X:120099860-120099882 TATTAAAGTCACCACAGCATGGG - Intergenic
1198933107 X:141880555-141880577 TCCTAAAGTCAGCACAGCAGAGG + Intronic
1198935095 X:141896228-141896250 TCCTAAAGTCAGCACAGCAGAGG + Intronic
1198960066 X:142174390-142174412 TCCTAAAGTCAGCACAGCAGGGG - Intergenic
1199754325 X:150850330-150850352 CATTAAGGCCAGCTCAGCAGTGG + Intronic