ID: 905307730

View in Genome Browser
Species Human (GRCh38)
Location 1:37031013-37031035
Sequence CCGTGGGGACCTGAATTTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 111
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 99}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905307730_905307737 -1 Left 905307730 1:37031013-37031035 CCTGGAAATTCAGGTCCCCACGG 0: 1
1: 0
2: 0
3: 11
4: 99
Right 905307737 1:37031035-37031057 GGAGGTCACTGAAGCCCGTTTGG 0: 1
1: 0
2: 1
3: 8
4: 109

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905307730 Original CRISPR CCGTGGGGACCTGAATTTCC AGG (reversed) Intronic
901011715 1:6206154-6206176 CGGTGCGGGCCTGAACTTCCAGG + Exonic
905169092 1:36099145-36099167 CCTTGGGCACCTGGTTTTCCAGG + Exonic
905217968 1:36423372-36423394 CCTTGGGGAACTGAAGTTCCAGG - Exonic
905307730 1:37031013-37031035 CCGTGGGGACCTGAATTTCCAGG - Intronic
905732079 1:40304345-40304367 CCTTGGGGCCCTGGAATTCCGGG + Exonic
906126630 1:43431046-43431068 CCGTGGGGAGCTCCACTTCCAGG - Exonic
913661926 1:121012324-121012346 CCTTGAGGACCTGAGTTTTCAGG - Intergenic
914013303 1:143795509-143795531 CCTTGAGGACCTGAGTTTTCAGG - Intergenic
914651925 1:149704118-149704140 CCTTGAGGACCTGAGTTTTCAGG - Exonic
915283021 1:154835646-154835668 CCTTGGTGACTTGAATTTCTTGG + Intronic
919411265 1:197246049-197246071 CCTGGGGAACCTGAATTTCCTGG - Intergenic
923724416 1:236494172-236494194 CCATGGGGACTTGGAATTCCAGG - Intergenic
923934907 1:238749010-238749032 ACTTGGTGACCTGCATTTCCAGG - Intergenic
1063372446 10:5530605-5530627 CCTTGGGGAGCTGAACATCCAGG + Intergenic
1074753202 10:116606527-116606549 CCTTGGGGAGCTGAATTTAGAGG - Intronic
1076168518 10:128301547-128301569 CCCTGGTGACCTGATTCTCCTGG + Intergenic
1076742463 10:132493527-132493549 CCATGGAGACCTGAGGTTCCGGG + Intergenic
1077336551 11:2007529-2007551 CTGGGTGGACATGAATTTCCGGG + Intergenic
1077336560 11:2007566-2007588 CTGGGTGGACATGAATTTCCGGG + Intergenic
1077336568 11:2007603-2007625 CTGGGTGGACATGAATTTCCAGG + Intergenic
1078220111 11:9344742-9344764 CCCTTGAGACCTGAATTTCTAGG + Intergenic
1083989928 11:66240642-66240664 CCCTGGGGACCTCAGGTTCCTGG + Intronic
1084175105 11:67418859-67418881 CCCTGGGGGCCTGACATTCCTGG + Exonic
1085273381 11:75283427-75283449 CCGGGAGGACCTGGATGTCCTGG - Exonic
1088135748 11:106553281-106553303 CTTTGGGGCCCTGAAGTTCCTGG + Intergenic
1088221118 11:107570820-107570842 CCATTGGGAGCTGTATTTCCTGG - Intergenic
1088499666 11:110471153-110471175 CCCTGGGAAGCTGACTTTCCTGG + Intergenic
1088821619 11:113461926-113461948 CCATGGGAACCTGGATTTCTGGG - Intronic
1091116302 11:133016821-133016843 CAGAGTGGGCCTGAATTTCCAGG - Intronic
1202819535 11_KI270721v1_random:62711-62733 CTGGGTGGACATGAATTTCCGGG + Intergenic
1202819544 11_KI270721v1_random:62748-62770 CTGGGTGGACATGAATTTCCGGG + Intergenic
1202819552 11_KI270721v1_random:62785-62807 CTGGGTGGACATGAATTTCCAGG + Intergenic
1091641521 12:2240857-2240879 CCCTCAGGGCCTGAATTTCCAGG + Intronic
1097298882 12:57997442-57997464 CTTTGGGGACCTGCAGTTCCTGG - Intergenic
1110810756 13:79808500-79808522 CTTTGGGGCCCTGCATTTCCTGG + Intergenic
1111975841 13:94966843-94966865 CCTTGGGGACTTGAATTGCTGGG - Intergenic
1113716376 13:112511261-112511283 CCGCGGGCACCTGCCTTTCCTGG + Intronic
1113799557 13:113079295-113079317 CTCTGGGGACCTGCATTCCCTGG - Intronic
1113911510 13:113843501-113843523 CTGTGGGGACCTGACCTTCCTGG + Intronic
1118865877 14:69703231-69703253 CAGTGGCAACCTGAGTTTCCAGG + Intronic
1127332965 15:57956504-57956526 CCGTGGGCACCTGAGTTGACAGG + Intronic
1132464396 16:71140-71162 CCTTGGGGAGCTGACTTTCTAGG - Intronic
1138179497 16:54932291-54932313 CAGCGGGGACCTCAATTTCTGGG - Intronic
1139467183 16:67160180-67160202 CCCTGGAGACCAGAATTTTCTGG + Exonic
1139923693 16:70474444-70474466 CTTTGGGGACCTGACTGTCCCGG - Intronic
1148520408 17:48269464-48269486 CCTGAGGGACCTGTATTTCCAGG + Intronic
1152414040 17:80147449-80147471 GCGTGTGGACCTGAATTCCCTGG + Intergenic
1154298928 18:13175663-13175685 CCGTGGTCACCTAAATCTCCTGG + Intergenic
1156244344 18:35283706-35283728 CGTTGGGGCCCTGCATTTCCTGG - Intronic
1160463258 18:79055299-79055321 GCCTGGGGACCTGAATATGCTGG - Intergenic
1160477041 18:79200815-79200837 GGGTGGGGCCCTGGATTTCCAGG + Intronic
1160586582 18:79916615-79916637 CCGGGGAGAGCTGAATTTGCGGG + Intronic
1162111834 19:8403766-8403788 CTGTGGGGACCCGAGTTTCATGG - Exonic
1164930353 19:32170484-32170506 CCTTGGGGACCTGAAGTTATAGG - Intergenic
1167758602 19:51428825-51428847 CAGTGGCCACCTGCATTTCCGGG - Intergenic
1167890528 19:52536106-52536128 CCGTGGGGACCCCACTTTCCAGG - Intronic
1168524047 19:57074636-57074658 CCGTGGGGACATGACTTACCTGG - Intergenic
927172102 2:20379023-20379045 CAGTGGGAAGCTGAATTGCCCGG + Intergenic
927276345 2:21265577-21265599 CAGTGGGGATATTAATTTCCAGG + Intergenic
928329513 2:30346921-30346943 CCGTGGGGATCTGGTTTACCAGG + Intergenic
931251590 2:60535877-60535899 TCGTGGGAACCTGGATTTGCAGG + Intronic
937815502 2:126246163-126246185 CAGTAGGGACCTGGATTCCCTGG - Intergenic
938079140 2:128360031-128360053 CCGTGGGACCCTGAGTGTCCAGG + Intergenic
945059471 2:205896255-205896277 CTGTGGGGACCTGGCTTGCCTGG - Intergenic
947169225 2:227294486-227294508 CCATGAGGACCTGGCTTTCCTGG - Exonic
948469788 2:238169823-238169845 ACGTGGGAAGCAGAATTTCCGGG + Intergenic
1171748018 20:29018779-29018801 CCCTGGTGAGCTGCATTTCCAGG - Intergenic
1173862640 20:46294312-46294334 CTGTGGGGTCCTGAGTTTCTAGG + Intronic
1176052723 20:63129052-63129074 ACGTGGGCACCTGACTTTCCTGG + Intergenic
1176317508 21:5260905-5260927 CCCTGGTGAGCTGCATTTCCAGG + Intergenic
1176428555 21:6562992-6563014 CCCTGGTGACCTGCATCTCCTGG + Intergenic
1179704045 21:43171308-43171330 CCCTGGTGACCTGCATCTCCTGG + Intronic
1180395179 22:12325319-12325341 CCCTGGTGAGCTGCATTTCCAGG + Intergenic
1180404561 22:12539432-12539454 CCGTGGTGAGCTGCATTTCCAGG - Intergenic
1181894062 22:26091252-26091274 CCCATGGGACCTGAATTTCATGG + Intergenic
951251906 3:20403801-20403823 CCCTGGAAACCTGAACTTCCTGG - Intergenic
953432715 3:42852953-42852975 CAGTGTGGCCCTGGATTTCCTGG + Intronic
954488064 3:50873210-50873232 CCCTGGGGCCCTGAATAACCAGG - Intronic
962103536 3:132367473-132367495 CAGTGGGGAGCTGAATCTCAAGG + Intronic
962419509 3:135215712-135215734 CCCTGGGGACCAGAGTTTCCTGG + Intronic
968105844 3:196000525-196000547 CGGGGGGGAGCTGAAGTTCCAGG - Intergenic
971621346 4:28857378-28857400 CAGTAGTGACCTGATTTTCCAGG + Intergenic
974208125 4:58734161-58734183 CCCTGGGGAGCTGAATATCTAGG - Intergenic
976734436 4:88296039-88296061 CTTTGGGGCCCTGAAATTCCTGG - Intergenic
990310626 5:54534431-54534453 CTGTGGGGACCTGAGTTTGGGGG + Intronic
995526019 5:113051184-113051206 CCGTGGGGCCCTGAGGATCCTGG - Intronic
998548991 5:143058386-143058408 CAGTAGGGACCTGATTTTCTTGG + Intronic
999231738 5:150065771-150065793 CCAGGGGCAGCTGAATTTCCTGG + Intronic
999396881 5:151235160-151235182 CCTTGGGAACCTGGATTTCTGGG + Intronic
1002523475 5:179803753-179803775 CCGTGGGGCCCTTTATCTCCTGG - Intronic
1003290908 6:4776992-4777014 CCGGGGGGTCCTGAAGTTGCCGG + Intronic
1003665983 6:8111746-8111768 CCCTGGGCACCTCAACTTCCCGG + Intergenic
1007962045 6:45968822-45968844 CCCTGGTGAACTGAATTCCCTGG + Intronic
1011860296 6:91746851-91746873 CCATGGGAACATGAATTTCTTGG + Intergenic
1012474282 6:99603639-99603661 CCGTGGGGACCTGAAACTCAAGG + Intergenic
1014475712 6:121870298-121870320 CCGTGGTGAGCTGAGCTTCCTGG - Intergenic
1018644141 6:165932076-165932098 CTGTGTGGAGCTGCATTTCCTGG - Intronic
1019322313 7:421316-421338 CGGTGGGGAGCGTAATTTCCAGG - Intergenic
1019537622 7:1537481-1537503 CCGTGGGGACCTGCAAATGCCGG - Intronic
1019726239 7:2604318-2604340 CCGGGCTGATCTGAATTTCCTGG + Intronic
1022848937 7:34240083-34240105 ACGGGGGGACCTGCATTTACTGG - Intergenic
1038593032 8:28858127-28858149 CTGTGGGGTCATGAATTTCCTGG - Intronic
1052820386 9:33133842-33133864 CAGTGGGCATCTCAATTTCCAGG + Intronic
1060602402 9:124886948-124886970 TCGAGGGGACCTGAATGCCCAGG + Intronic
1061432305 9:130538839-130538861 CCGTGGGGACCTTACAGTCCAGG - Intergenic
1203410813 Un_KI270579v1:362-384 CCCTGGTGAGCTGCATTTCCAGG + Intergenic
1203410218 Un_KI270581v1:1343-1365 CCCTGGTGAGCTGCATTTCCAGG - Intergenic
1203415770 Un_KI270582v1:5952-5974 CCCTGGTGAGCTGCATTTCCAGG + Intergenic
1187232767 X:17438298-17438320 CCGTGGGGCCATGAAGTTTCTGG - Intronic
1189220727 X:39369424-39369446 ACATGGGGACCTCAATTCCCTGG + Intergenic
1190100349 X:47518082-47518104 CCGTGGGGACCTGGGCTCCCTGG + Intergenic