ID: 905307840

View in Genome Browser
Species Human (GRCh38)
Location 1:37031828-37031850
Sequence CTTGAACCCCAGCTGGAGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 280
Summary {0: 1, 1: 0, 2: 1, 3: 30, 4: 248}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905307840_905307845 -8 Left 905307840 1:37031828-37031850 CCTGGCTCCAGCTGGGGTTCAAG 0: 1
1: 0
2: 1
3: 30
4: 248
Right 905307845 1:37031843-37031865 GGTTCAAGCAGGGGCTCAGAAGG 0: 1
1: 0
2: 3
3: 18
4: 146
905307840_905307846 13 Left 905307840 1:37031828-37031850 CCTGGCTCCAGCTGGGGTTCAAG 0: 1
1: 0
2: 1
3: 30
4: 248
Right 905307846 1:37031864-37031886 GGACAGAAACTCAGCTCCCCAGG 0: 1
1: 0
2: 1
3: 29
4: 213
905307840_905307847 25 Left 905307840 1:37031828-37031850 CCTGGCTCCAGCTGGGGTTCAAG 0: 1
1: 0
2: 1
3: 30
4: 248
Right 905307847 1:37031876-37031898 AGCTCCCCAGGAGTCTCCAGAGG 0: 1
1: 0
2: 3
3: 42
4: 508

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905307840 Original CRISPR CTTGAACCCCAGCTGGAGCC AGG (reversed) Intronic
900102892 1:970392-970414 CTGGAACCGCAGCTGGACCTTGG - Exonic
900555944 1:3280567-3280589 CTCGACTCCCACCTGGAGCCTGG + Intronic
900644523 1:3702953-3702975 CTTGACCCCGAGCAGGAGCCAGG + Intronic
900804716 1:4759877-4759899 CTCCATCCACAGCTGGAGCCTGG - Intronic
900832919 1:4977962-4977984 CTTGAACCCAAGCTGAACTCTGG - Intergenic
901145639 1:7062773-7062795 CTGGAGCCCCAGCGGAAGCCTGG - Intronic
902078090 1:13803267-13803289 GTTGAACCGCACCAGGAGCCTGG + Intronic
905307840 1:37031828-37031850 CTTGAACCCCAGCTGGAGCCAGG - Intronic
905653001 1:39668932-39668954 CTTCAGCTCCACCTGGAGCCTGG - Intronic
906032802 1:42734374-42734396 CTTGGACCTCAGCTGGATGCTGG + Exonic
906528633 1:46510924-46510946 CTTGAACCACACCTGGGGACGGG - Exonic
908707562 1:66976083-66976105 CTTGAACCCCAGCAGGGGGTGGG - Intronic
914490125 1:148146509-148146531 CCTGAGCCCGAGCTGGGGCCTGG + Intronic
915500268 1:156311122-156311144 CTGGACCCTCAGCTGGTGCCAGG - Exonic
916515584 1:165513441-165513463 CATGATCACCATCTGGAGCCTGG - Intergenic
916850278 1:168696228-168696250 CTGGAGCACCAGCTGCAGCCTGG - Exonic
917693238 1:177490515-177490537 CTTGAAACCCAGCAGGATGCTGG - Intergenic
918148532 1:181779119-181779141 CTAGAAGCCTAGCTAGAGCCAGG + Intronic
919664891 1:200282569-200282591 CCTGAACCACACCTGCAGCCTGG + Intergenic
922534814 1:226372029-226372051 CACGAGCCCCAGCTGCAGCCAGG + Intronic
922726553 1:227925553-227925575 CAGGAAGCCCTGCTGGAGCCTGG + Intronic
923571231 1:235116615-235116637 CTTGAACCCTCGCTTGAACCCGG + Intronic
924594575 1:245434382-245434404 CTTGCAGCCCAGCTGGACCCTGG - Intronic
924709732 1:246522360-246522382 CCTGAAACCCAGAGGGAGCCAGG + Intergenic
924944648 1:248838238-248838260 CTCCGGCCCCAGCTGGAGCCGGG - Intronic
1064270218 10:13858768-13858790 CTTCATCCCCAGCTGGATCAAGG + Intronic
1065677366 10:28192040-28192062 CTTGAACCCCAGAGGCAGCCTGG + Intronic
1069479073 10:68764200-68764222 ATTGAAACCCAGATGGAGCAAGG - Intronic
1070724208 10:78777439-78777461 CCTGCCCCCCAGCTGGACCCTGG + Intergenic
1071728740 10:88226410-88226432 TTTGAGTCCCAGCTGGAGCTGGG - Intergenic
1072525551 10:96268364-96268386 ATTGAAACCCAGCTCTAGCCAGG + Intronic
1073222819 10:101890456-101890478 CTTGAGCCCAGGCTTGAGCCTGG - Intronic
1074110515 10:110419468-110419490 TTTGAACCCCGTCTGTAGCCTGG - Intergenic
1074776315 10:116770628-116770650 CTAGCACTCCAGCTGGAGCTCGG - Intergenic
1075099264 10:119494444-119494466 CTTCACACACAGCTGGAGCCAGG - Intergenic
1075252056 10:120888355-120888377 CTTGAATCCCAGCTTGAAACTGG - Intronic
1075687384 10:124373746-124373768 CTTCAAGCCCAGCTGGACCCAGG - Intergenic
1075838550 10:125477272-125477294 CATGAACTCCTGCTGGAGCCAGG - Intergenic
1075876511 10:125810685-125810707 CTAGAATCTCAGCAGGAGCCTGG - Intronic
1076134896 10:128038839-128038861 CCTGTCCACCAGCTGGAGCCCGG - Intronic
1076441859 10:130485716-130485738 CTTGCCTCCCAGCTGGGGCCAGG + Intergenic
1076647385 10:131962593-131962615 CCTGAAACTCAGCTGGAGACTGG + Intergenic
1076851386 10:133095150-133095172 CAGGAGCCCCAGCTGGAGCTCGG + Intronic
1077343594 11:2036645-2036667 CTCTAACTCCAGCTGCAGCCTGG - Intergenic
1077491600 11:2863237-2863259 CTCCAGCCCCAGCAGGAGCCTGG + Intergenic
1077522281 11:3043465-3043487 CTCTGACCCCAGCTGGTGCCTGG + Intronic
1077661104 11:4069301-4069323 TTTGAACCCCAGCTGGTGGCTGG + Intronic
1077864271 11:6210283-6210305 CGTCAGCCCCAGCTGCAGCCAGG - Exonic
1079128592 11:17735158-17735180 GCGGAACCCCAGCTCGAGCCCGG + Exonic
1079282071 11:19096566-19096588 CTAGAAACACAGCTGGAGACTGG + Intergenic
1080551319 11:33376150-33376172 CGGGAACCCGAGCCGGAGCCGGG + Intergenic
1080640524 11:34155796-34155818 CTGCAGCCCCTGCTGGAGCCTGG + Intronic
1081739172 11:45426083-45426105 CATGAAACCCAGCTGGAACTGGG - Intergenic
1082030649 11:47601007-47601029 CTGGTACCGCAGCTGGGGCCAGG - Intergenic
1083211993 11:61193938-61193960 CTTCAGCCCCAGCTCGAGCTGGG + Intergenic
1083373221 11:62198549-62198571 CGTGCACCCCGGATGGAGCCTGG - Intergenic
1085449013 11:76620574-76620596 CTGGAACCCCAGCAGGGGCATGG + Intergenic
1088004822 11:104927354-104927376 CTTTTCCCCCCGCTGGAGCCAGG + Intergenic
1088210866 11:107454155-107454177 AGTGAACACCAGCTGTAGCCAGG + Intronic
1089837384 11:121383133-121383155 CTAGAATCCCAGTTGGAGCTTGG + Intergenic
1202826580 11_KI270721v1_random:91834-91856 CTCTAACTCCAGCTGCAGCCTGG - Intergenic
1093289110 12:17300362-17300384 CTTGAACCCTTGGGGGAGCCGGG - Intergenic
1094199565 12:27781778-27781800 CATGACCCACAGCTTGAGCCTGG + Intronic
1095838849 12:46669797-46669819 TTTGAGCTGCAGCTGGAGCCAGG + Intergenic
1096816635 12:54205845-54205867 CCTGAGCCCCATCTGGGGCCAGG + Intergenic
1098032286 12:66267076-66267098 GCTGCACCCCAGCTGGAGACAGG - Intergenic
1100983976 12:100187670-100187692 CTTGAATGCCAGCTGAAGCCTGG - Intergenic
1101653616 12:106700067-106700089 ACTGTACTCCAGCTGGAGCCTGG - Intronic
1102566608 12:113801356-113801378 CTGGACCCCCAGCTGAAGGCCGG - Intergenic
1103478605 12:121236396-121236418 CATGAACACCAGCAGGAGGCTGG + Intergenic
1103535791 12:121633096-121633118 CATGGAGCCCAGCAGGAGCCAGG + Intronic
1103877562 12:124140474-124140496 ATTAAACCCCAGCTTGATCCAGG + Intronic
1103956976 12:124582748-124582770 TTAGAACCCCAGTTGCAGCCCGG + Intergenic
1104684720 12:130777415-130777437 CTTCAGACCCAGCTGGATCCTGG + Intergenic
1109306015 13:60642718-60642740 CTTGAATGTCAGCTGGAGTCGGG + Intergenic
1110404425 13:75133959-75133981 CTAGAACTCTTGCTGGAGCCTGG + Intergenic
1113267186 13:108632819-108632841 CTTGCGCCTCAGCTGGGGCCTGG - Intronic
1115826378 14:37282653-37282675 GGTGAAACCCCGCTGGAGCCTGG + Intronic
1119419818 14:74501859-74501881 CCCAAACCCCAGCAGGAGCCGGG - Intronic
1119928858 14:78524780-78524802 CTTGAACTCCACCTGGACCTAGG + Intronic
1121955052 14:98205923-98205945 CCTGACCCACAGCTAGAGCCAGG + Intergenic
1122676980 14:103423646-103423668 CTTGGCCCAGAGCTGGAGCCTGG - Intronic
1122924820 14:104894724-104894746 CGTGGACCCCAGTGGGAGCCTGG + Exonic
1124629262 15:31327603-31327625 CTGGAGCCCGAGCGGGAGCCGGG + Exonic
1124998203 15:34744751-34744773 CTTGGCCCCCACCTGGAGACAGG + Intergenic
1125492113 15:40155924-40155946 CTATAGCCCCAGCAGGAGCCTGG - Intergenic
1125613301 15:40987575-40987597 CATGAACAACAGCTGGATCCAGG + Intronic
1126909357 15:53401732-53401754 TATCAACCCCAGCTGGACCCTGG + Intergenic
1127505721 15:59596136-59596158 CTGGAACAGCAGCTGGAGTCTGG - Intronic
1127581052 15:60339777-60339799 CTTGAACCCCAGTGGAAGCCTGG - Intergenic
1129747758 15:78036852-78036874 CTTGAATGCCAGCTGAAGCCTGG - Intronic
1129771325 15:78205110-78205132 CTTGAAGCCCAGCAGGAGAAGGG - Intronic
1131786846 15:95922569-95922591 CATGAACCTCTGCTGCAGCCTGG - Intergenic
1132146313 15:99431955-99431977 CCAGAACCCCAGCTGGTGCGGGG + Intergenic
1132208553 15:100003249-100003271 CTAGAACCCCAGGTGGAGCTGGG - Intronic
1132495417 16:260974-260996 CTGCAACCCCAGCAGGAGGCAGG + Intronic
1132590594 16:724735-724757 CTTGAGCTGCAGCTGCAGCCGGG + Exonic
1132819928 16:1859910-1859932 CTGGAGCCTCAGCAGGAGCCGGG - Intronic
1133055941 16:3145516-3145538 CTTGAGCCTGAACTGGAGCCTGG + Intronic
1133598732 16:7318442-7318464 CTTGAACCAAATCTGAAGCCAGG - Intronic
1135048654 16:19174431-19174453 CAGGACCCACAGCTGGAGCCTGG + Intronic
1135992022 16:27224129-27224151 CTTGAACCCCAGCATCAGTCAGG - Intergenic
1136027119 16:27475652-27475674 ATCGAACCCCCGGTGGAGCCTGG - Intronic
1136059837 16:27718897-27718919 CCTCCACCGCAGCTGGAGCCTGG + Intronic
1136141655 16:28292593-28292615 CTGGAGCCGCAGCCGGAGCCCGG + Exonic
1136492617 16:30619426-30619448 CTTGCACAATAGCTGGAGCCTGG + Intronic
1136497942 16:30655236-30655258 CTTGAAGCCTGGCTGCAGCCTGG + Intronic
1137054327 16:35736080-35736102 CCTGAACCCCCGCTGCAGCCGGG + Intergenic
1137946036 16:52734153-52734175 CCTAAAGCCCAGCTGAAGCCTGG - Intergenic
1139364656 16:66426401-66426423 CTGGAACCCCGGCCTGAGCCAGG + Intergenic
1139740968 16:69034500-69034522 CTGTAACCACAGCTGGAGCCTGG - Intronic
1141464336 16:84196296-84196318 CCTGAGCCTCAACTGGAGCCTGG + Exonic
1141756174 16:85992453-85992475 CTTGAACACCTGCTAGTGCCGGG + Intergenic
1141856492 16:86684772-86684794 CGTGAAGCCCTGCTGGAGACGGG - Intergenic
1142476879 17:193985-194007 CTAGAACCCCAGAGGGAGCCGGG - Intergenic
1142496620 17:309592-309614 CTGGACCCCCAGCAGGAGGCTGG - Intronic
1142496660 17:309705-309727 CTGGACCCCCAGCAGGAGGCTGG - Intronic
1143012929 17:3876187-3876209 CTTGAACCCCAGCCTGGCCCAGG + Intronic
1143819734 17:9550683-9550705 TTTGAACCACAGATGGAGCGGGG + Intronic
1145077602 17:19868199-19868221 CTTGAACCCCAGCTGCAGGCAGG + Intergenic
1145882587 17:28363358-28363380 CTCTAATCCCAGCTGAAGCCTGG + Exonic
1147571961 17:41576877-41576899 ATTGATCCCCAGGTGGGGCCAGG + Intergenic
1148128727 17:45249943-45249965 CTTGGAGCCCTGCTGGTGCCTGG + Intergenic
1148745402 17:49915284-49915306 CTGGAACCCCAGTTGGTGACAGG - Intergenic
1149169466 17:53792230-53792252 CATGAACCCCACCTGGAACTGGG - Intergenic
1149518837 17:57303022-57303044 TCTGATCACCAGCTGGAGCCTGG - Intronic
1150414340 17:64975291-64975313 CTCCACCCCCAGCCGGAGCCTGG - Intergenic
1151388166 17:73768028-73768050 CTAGAACCCCAGCTGCATCTGGG - Intergenic
1151455321 17:74222344-74222366 CTTGAACCCTAGGTGGAGCTTGG + Intronic
1151908722 17:77066986-77067008 CTTGAATCCCAGCAGGAGTCTGG - Intergenic
1152659156 17:81534504-81534526 CAGGAACCCCAGATGGAGCCCGG + Intronic
1157321719 18:46639757-46639779 CTTGAATGCCAGCTGGTACCTGG - Intronic
1157483397 18:48070340-48070362 CCTGAATCCCAGCTGTAGGCTGG + Intronic
1157516657 18:48316101-48316123 TTTTAAGCCCAGCAGGAGCCGGG - Intronic
1158504662 18:58035919-58035941 CCTGAACCTGACCTGGAGCCTGG - Intergenic
1158817193 18:61116041-61116063 GTTGGACCCCAGCTGGAAACGGG - Intergenic
1159149401 18:64501778-64501800 ATTGAACCCCAGCTGGGTCTTGG + Intergenic
1160742080 19:691148-691170 TTGTAACCACAGCTGGAGCCGGG - Intronic
1160964901 19:1743054-1743076 CGTGCCCCCCAGCCGGAGCCGGG + Intergenic
1160972761 19:1776704-1776726 CTTGAACCCCCGGAGGAGGCGGG - Exonic
1161241492 19:3225781-3225803 CTTGAGCCCAAGGTGGAGGCGGG - Intronic
1161793602 19:6374549-6374571 CTGGAACTCTTGCTGGAGCCGGG + Exonic
1162064843 19:8119123-8119145 CCTTCACCCCAGCGGGAGCCAGG + Intronic
1164564847 19:29318485-29318507 CTTGAATCCCATCTGCACCCTGG + Intergenic
1164806263 19:31119406-31119428 CTTGAAGCCCAGCTGCATTCTGG - Intergenic
1165486725 19:36101025-36101047 CCTGTACCCCACCTGGAACCAGG - Intronic
1166737313 19:45093597-45093619 ATTGAACGCCACCTCGAGCCGGG - Intronic
1167942419 19:52958440-52958462 CTTGAACCCTTGCAGAAGCCGGG - Intronic
1168294712 19:55373050-55373072 CTTGCTCCCCAGCTGGCCCCAGG - Intergenic
925836586 2:7952430-7952452 CTCTAACCCCAGCGAGAGCCTGG + Intergenic
925932411 2:8719737-8719759 CTTTAACACCCCCTGGAGCCTGG + Intergenic
926887294 2:17609920-17609942 CTTTATCCCCACATGGAGCCCGG + Intronic
927297987 2:21477093-21477115 CTTGAACCCAAGCCAGGGCCTGG - Intergenic
928170683 2:29001137-29001159 CTTGAGCCCCAGCTGGGTCAGGG - Intronic
928262363 2:29779298-29779320 CTAGCACCCCACCTGGGGCCTGG + Intronic
931200360 2:60091817-60091839 GTAGAAACTCAGCTGGAGCCAGG - Intergenic
931228455 2:60353568-60353590 CCTGAGCCTCAGCTGGGGCCAGG - Intergenic
931804219 2:65788858-65788880 CATCAAGCCCAGCAGGAGCCAGG + Intergenic
932292566 2:70594853-70594875 CTTCTAACCCTGCTGGAGCCTGG + Intergenic
932837322 2:75049705-75049727 CTTGAAGCCCAGACGGAACCTGG + Exonic
943088589 2:183346965-183346987 CTTGAACCTGACCTGAAGCCTGG - Intergenic
946414014 2:219530300-219530322 CTAAATCCCCAGCGGGAGCCTGG + Intronic
947489757 2:230583422-230583444 CTTGGATTCCAGCTGGAGTCAGG + Intergenic
948466825 2:238156266-238156288 CTTGAGCCATAGCTGCAGCCAGG + Intergenic
948981526 2:241497149-241497171 CAGGAGCCCCACCTGGAGCCTGG - Intronic
1168920773 20:1533816-1533838 CCTCATCCCCAGCTGGAGCTTGG - Intergenic
1170540094 20:17379035-17379057 TTTGAACCACAGCTGTAGCCAGG - Intronic
1170688885 20:18594266-18594288 CCTGAACCCCAGTTAGAGTCTGG + Intronic
1170821097 20:19757008-19757030 ATTGAACACCTGCTGGTGCCAGG - Intergenic
1172022602 20:31925070-31925092 CTTTAACCCCTGCTGGAGGAGGG - Intronic
1172336827 20:34123263-34123285 CTGTAGCCACAGCTGGAGCCTGG - Intergenic
1173075322 20:39813046-39813068 CTGGAACCTTAGCTAGAGCCAGG - Intergenic
1173314542 20:41931441-41931463 TTTGAGCCACAGCTGGAGCTGGG + Intergenic
1173648025 20:44645844-44645866 CTTGGACACCAGCTGGGGTCAGG - Intronic
1174384605 20:50179674-50179696 CCTGAAGTCCAGCTGGAGCCTGG + Intergenic
1174398777 20:50264640-50264662 CTGGATCTTCAGCTGGAGCCAGG - Intergenic
1175623815 20:60473816-60473838 CCTGGACCCAAGCTGGAGGCAGG - Intergenic
1175876555 20:62232911-62232933 CTTGCCCCTCAGCTGGAGCTGGG - Intronic
1176124315 20:63468679-63468701 CCTGGACCCCAGCTGAGGCCTGG + Intronic
1178367524 21:31999670-31999692 CCTGAAGGCCAGCAGGAGCCGGG + Exonic
1178915641 21:36704429-36704451 CTGGATCCCCAGCTGCAGCCTGG - Intronic
1179709574 21:43205531-43205553 CCAGCAGCCCAGCTGGAGCCTGG - Intergenic
1180953333 22:19730513-19730535 CTTGAACCCCAGATGGGTCTTGG - Intergenic
1181524230 22:23470090-23470112 CTCCCACCCCAGCTGAAGCCCGG + Intergenic
1182618543 22:31604966-31604988 CTTGTTCCCCAGCTGGAGCTTGG - Intronic
1182740501 22:32563962-32563984 CTTGAAACCCAACAGGGGCCGGG - Intronic
1182907196 22:33948660-33948682 CTTGAGCACCAGCTTGTGCCTGG - Intergenic
1184144744 22:42603004-42603026 CTTGACTCCCAGTTTGAGCCGGG + Exonic
1184692220 22:46122600-46122622 CTTGACCACCAGGTGGCGCCTGG + Intergenic
1185070496 22:48653232-48653254 CTCCAACCCCATCTGGATCCAGG - Intronic
949119959 3:373466-373488 CTTTCTCCCCTGCTGGAGCCAGG - Intronic
949876078 3:8626855-8626877 CTTCAGGCCCAGCTGGATCCGGG - Intronic
950718905 3:14868517-14868539 GTTTAACCCCAGCTGGGGACTGG - Intronic
952840230 3:37640050-37640072 CTGGAAGCCCTGCTGTAGCCAGG - Intronic
953320202 3:41964370-41964392 CTTGGACCTCAGCTGGGGGCTGG + Intergenic
954043869 3:47912157-47912179 CTTGAACCCCAGAGGGATCTTGG - Intronic
954453296 3:50583320-50583342 CTTTACCCCCACCTGGACCCTGG + Exonic
961193944 3:124985721-124985743 CTTCACCCCCTGCTGGAGCAGGG - Intronic
961619870 3:128215691-128215713 CTTTAAGCACAGCTGGATCCAGG + Intronic
962835807 3:139187515-139187537 CCAGGATCCCAGCTGGAGCCAGG - Intronic
963640731 3:147858494-147858516 TTTGAGCCGCAGCTGGAGCTGGG + Intergenic
965741856 3:171883957-171883979 CTTCAAGCCCAGCTAGAGGCAGG + Intronic
966392709 3:179469183-179469205 CATGAAACCAAGCTGTAGCCTGG + Intergenic
968856402 4:3127448-3127470 CTTGAGCCACAGCTCCAGCCAGG + Exonic
968931411 4:3581483-3581505 CTCGAGCCCCATCTGGAGCCAGG - Intronic
969720479 4:8890735-8890757 ATGGAACCCCTCCTGGAGCCAGG - Intergenic
969973543 4:11073435-11073457 CTTGAGCCCCAGGTGGAAACAGG - Intergenic
970387876 4:15574285-15574307 ATTGAGCCCCAGCTGGTTCCTGG + Exonic
974314857 4:60266299-60266321 CTGGAACCCCACCTGGAGATGGG + Intergenic
974469723 4:62302816-62302838 CTCTGAACCCAGCTGGAGCCTGG + Intergenic
976000799 4:80371166-80371188 TTTGAGCCACAGCTGGAGCTGGG + Intronic
979978359 4:127224653-127224675 CTTTTTCCCCTGCTGGAGCCAGG - Intergenic
982738789 4:159036296-159036318 CTTGTAGCCCAGCTGGAGGAAGG + Intronic
987051319 5:14148876-14148898 CTGGGTCCCCAGCTGGAGCAAGG + Intronic
989710423 5:44389883-44389905 CTTGAGAGCCACCTGGAGCCTGG + Intergenic
990299966 5:54440385-54440407 CTTGAACAGCAGATGGGGCCGGG + Intergenic
995903349 5:117094396-117094418 CATGAACCCCAGATGAGGCCTGG - Intergenic
997609836 5:135208114-135208136 CCTGACCCCCAGCTGTGGCCAGG + Intronic
998413039 5:141925426-141925448 CTTGGACCCCCGCTCGTGCCTGG - Exonic
1001109744 5:168885744-168885766 CTTGAACCATAGCTGGAAGCTGG + Intronic
1001342802 5:170862509-170862531 GTTGAGCCCCAGCCGGAGCGGGG + Intronic
1002080631 5:176735200-176735222 CTTCAGGCCCAGCTGGATCCAGG - Intergenic
1002125902 5:177043821-177043843 CTTCACACCCAGCTGGAGTCTGG - Intronic
1002487647 5:179550615-179550637 CTGGAGCCGGAGCTGGAGCCGGG + Exonic
1002513722 5:179741221-179741243 ATTGAAGTCCTGCTGGAGCCAGG + Intronic
1002639490 5:180623970-180623992 CGTGAACCCCATCGAGAGCCTGG - Exonic
1002845812 6:943233-943255 CTTGAACCCCAACAGAAGCTGGG - Intergenic
1003715358 6:8640228-8640250 CTTGGACCCAATCTGAAGCCTGG + Intergenic
1005700159 6:28392901-28392923 CTTGAATCCCAACAGGAGCAAGG - Exonic
1006787630 6:36679087-36679109 CTGGAAACCCAGCTGGGGCGAGG + Intronic
1007089088 6:39170752-39170774 CTGTAACCCCACCTGGAGCTTGG - Intergenic
1010104784 6:72154832-72154854 CTTGCACACCAGAAGGAGCCAGG - Intronic
1011565166 6:88665692-88665714 CTTGAACCCCTGGGGAAGCCGGG - Intronic
1012063056 6:94511850-94511872 CCTGCTCCCCTGCTGGAGCCAGG + Intergenic
1013275250 6:108578898-108578920 CTTGCACCACAGGTGGAACCAGG + Intronic
1015613845 6:135054593-135054615 CTAGGATCCCAGCTGTAGCCGGG + Intronic
1017021465 6:150143292-150143314 CCTGAGCCGCTGCTGGAGCCGGG - Exonic
1019442469 7:1054423-1054445 CCTGAACCCCACCTGGAGGCCGG + Intronic
1022892342 7:34714300-34714322 CCTGAACCCTGGCTGGAGCTGGG - Intronic
1023613173 7:41992188-41992210 CTTGAACTACAGCAGTAGCCAGG + Intronic
1023822422 7:43987621-43987643 CATGCACCCAAGCCGGAGCCTGG - Intergenic
1027395317 7:77747481-77747503 TTTGAGCCACAGCTGGAGCTGGG - Intronic
1029750685 7:102541036-102541058 CATGCACCCAAGCCGGAGCCTGG - Intronic
1029768640 7:102640147-102640169 CATGCACCCAAGCCGGAGCCTGG - Intronic
1032085056 7:128879510-128879532 CTGGAGCCGCACCTGGAGCCCGG + Exonic
1032200070 7:129814565-129814587 CTGTCACCCCAGCTGGAGGCTGG + Intergenic
1034040566 7:147873125-147873147 CTTGATCCCAAGCTGGAGCGTGG - Intronic
1034256833 7:149729302-149729324 TTTGAACCCCCGCTGGTGGCAGG - Exonic
1034447034 7:151119008-151119030 CTGGAATACCAGCTGCAGCCAGG - Intronic
1034466911 7:151235204-151235226 CCTGCATCCCTGCTGGAGCCCGG - Exonic
1034895999 7:154876759-154876781 CCTGAAGGCCAGCTGCAGCCTGG - Intronic
1037834555 8:22208457-22208479 CATGAGCCCAAGCGGGAGCCAGG + Intronic
1039278191 8:35955033-35955055 CTTGAACCCTTGGAGGAGCCGGG - Intergenic
1045273687 8:100682801-100682823 CTTGGCCCCAAACTGGAGCCAGG - Intergenic
1052857418 9:33415909-33415931 CATGAACTCCAGCCTGAGCCCGG - Intergenic
1053218166 9:36289886-36289908 CTTGAACCGCAGCTGCTTCCTGG + Intronic
1053527077 9:38841145-38841167 CTTGAAACCCACCTGCAGCCTGG - Intergenic
1054199300 9:62065576-62065598 CTTGAAACCCACCTGCAGCCTGG - Intergenic
1054458716 9:65450446-65450468 CTCGAGCCCCATCTGGAGCCAGG + Intergenic
1054639053 9:67522781-67522803 CTTGAAACCCACCTGCAGCCTGG + Intergenic
1057525739 9:95798947-95798969 CTAGAATCCCAGTTGGGGCCAGG + Intergenic
1059204929 9:112455612-112455634 CTTAAACCTCAGCTGAAGCGGGG - Intronic
1059668039 9:116467595-116467617 CTTCAGCCCCAGCTGAATCCAGG - Intronic
1060489071 9:124068696-124068718 CTTGAACCTGACCTGAAGCCTGG + Intergenic
1060552737 9:124493175-124493197 CCTGGACCCTGGCTGGAGCCCGG - Intronic
1060962409 9:127690437-127690459 CTTAAACTCCAGGTGAAGCCAGG - Intronic
1061800978 9:133113292-133113314 CCTCAACCCCAGCAGGAGCCAGG + Intronic
1061868150 9:133506058-133506080 CTAGAGCCCCGGCTGGAGCCAGG - Intergenic
1062013308 9:134278351-134278373 CCTGAACCCAACCTGCAGCCTGG + Intergenic
1062133949 9:134914913-134914935 CTTGAACCCCTTCTGGTTCCAGG + Intronic
1062453989 9:136627185-136627207 CAGGAAGCCCAGCTGGAGCACGG + Intergenic
1062536454 9:137023203-137023225 CCTGTAGCCCAGCTGGGGCCAGG - Intronic
1186841969 X:13493475-13493497 GCTGAACCCCATCTGGAGCTAGG + Intergenic
1187823610 X:23313555-23313577 CTTGTATCCCAGCTGGGGCCTGG - Intergenic
1190026558 X:46929093-46929115 CTAGAAACCAAACTGGAGCCAGG - Intronic
1190159735 X:48022572-48022594 CTGGAACCCCAAAGGGAGCCAGG + Intronic
1190315073 X:49145454-49145476 CTTGAACCCTTGGGGGAGCCGGG + Intergenic
1190711217 X:53072019-53072041 CTTGAGCCTCAGCTGGGCCCGGG + Intronic
1197010151 X:121551146-121551168 CTTCAACCCCAGCAGCAGCAGGG + Intergenic
1200143131 X:153911818-153911840 CTTGAACCCCAGCAGGTGGGAGG + Intronic