ID: 905308388

View in Genome Browser
Species Human (GRCh38)
Location 1:37034075-37034097
Sequence CTGGCGGCGCCTCCGGAGTC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 96
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 92}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905308388_905308395 -5 Left 905308388 1:37034075-37034097 CCAGACTCCGGAGGCGCCGCCAG 0: 1
1: 0
2: 0
3: 3
4: 92
Right 905308395 1:37034093-37034115 GCCAGGGAGCGGTCATCGTTGGG 0: 1
1: 0
2: 0
3: 1
4: 70
905308388_905308394 -6 Left 905308388 1:37034075-37034097 CCAGACTCCGGAGGCGCCGCCAG 0: 1
1: 0
2: 0
3: 3
4: 92
Right 905308394 1:37034092-37034114 CGCCAGGGAGCGGTCATCGTTGG 0: 1
1: 0
2: 0
3: 2
4: 64
905308388_905308399 16 Left 905308388 1:37034075-37034097 CCAGACTCCGGAGGCGCCGCCAG 0: 1
1: 0
2: 0
3: 3
4: 92
Right 905308399 1:37034114-37034136 GGCGCCGCCGAGCGTGCCCGGGG 0: 1
1: 0
2: 1
3: 8
4: 135
905308388_905308404 30 Left 905308388 1:37034075-37034097 CCAGACTCCGGAGGCGCCGCCAG 0: 1
1: 0
2: 0
3: 3
4: 92
Right 905308404 1:37034128-37034150 TGCCCGGGGCGCGGCCGTGGCGG 0: 1
1: 0
2: 3
3: 24
4: 300
905308388_905308397 14 Left 905308388 1:37034075-37034097 CCAGACTCCGGAGGCGCCGCCAG 0: 1
1: 0
2: 0
3: 3
4: 92
Right 905308397 1:37034112-37034134 TGGGCGCCGCCGAGCGTGCCCGG 0: 1
1: 0
2: 0
3: 4
4: 91
905308388_905308403 27 Left 905308388 1:37034075-37034097 CCAGACTCCGGAGGCGCCGCCAG 0: 1
1: 0
2: 0
3: 3
4: 92
Right 905308403 1:37034125-37034147 GCGTGCCCGGGGCGCGGCCGTGG 0: 1
1: 0
2: 10
3: 57
4: 518
905308388_905308401 21 Left 905308388 1:37034075-37034097 CCAGACTCCGGAGGCGCCGCCAG 0: 1
1: 0
2: 0
3: 3
4: 92
Right 905308401 1:37034119-37034141 CGCCGAGCGTGCCCGGGGCGCGG 0: 1
1: 0
2: 0
3: 15
4: 217
905308388_905308398 15 Left 905308388 1:37034075-37034097 CCAGACTCCGGAGGCGCCGCCAG 0: 1
1: 0
2: 0
3: 3
4: 92
Right 905308398 1:37034113-37034135 GGGCGCCGCCGAGCGTGCCCGGG 0: 1
1: 0
2: 0
3: 8
4: 176

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905308388 Original CRISPR CTGGCGGCGCCTCCGGAGTC TGG (reversed) Exonic
900422906 1:2563340-2563362 CTGGCGGAACCACCGGAGCCCGG + Exonic
900537601 1:3186560-3186582 CTGGCCGCGCCTCCCGCCTCGGG - Intronic
901017923 1:6242353-6242375 CTGGCGGGGCGCCCGGAGTTTGG + Intergenic
902783182 1:18717242-18717264 CGAGCGGCGGCTCCGCAGTCCGG - Intronic
903959195 1:27046144-27046166 CTTGCGGCCCCGCAGGAGTCAGG + Intergenic
904822876 1:33256623-33256645 CTGGCGGCGCCTCCGGGACGCGG - Exonic
905308388 1:37034075-37034097 CTGGCGGCGCCTCCGGAGTCTGG - Exonic
905883455 1:41479171-41479193 CTGGAGGCTGCTCCGCAGTCTGG + Exonic
908380641 1:63593956-63593978 CTCCCGGCGCCCCGGGAGTCAGG - Intronic
912401646 1:109398065-109398087 CTCGCGTCGCCTCCGGCTTCGGG + Intergenic
912793502 1:112675297-112675319 CTGCCCGCGCCCCCGGAGGCCGG + Intronic
915462180 1:156076802-156076824 CGGGGGGCGCCTCGGGAGTCCGG + Exonic
920886956 1:209938414-209938436 CTGGCCGCGTCTCGGGAGGCGGG + Intronic
1073812411 10:107164878-107164900 CCGGCGGCGCCTCCAGCGCCCGG - Intergenic
1073921713 10:108466563-108466585 CCGGCGGCGCCTCCAGCGCCCGG - Intergenic
1077406503 11:2384615-2384637 CAGAGGGCGCCTCCGGAGGCTGG + Intronic
1083224490 11:61276300-61276322 CTGCCTGAGCCTCCGGAGTAGGG - Intronic
1083728052 11:64638474-64638496 CTGAAGGCGCCTCCGGAGCGCGG - Intronic
1083936641 11:65872939-65872961 CTGGCGGCGCCGCGGGGGACCGG - Intronic
1088597547 11:111451280-111451302 CTGGCGGCGCTTCCGGGCCCTGG + Intronic
1089305657 11:117524744-117524766 CTGAGGGCGCCTCAGGGGTCGGG - Intronic
1089496182 11:118909725-118909747 CTGGCTGCGCCTCCTGCCTCGGG + Intronic
1090375134 11:126283057-126283079 CGGGCGGCGCTTCCGGAGAGCGG + Intronic
1095876110 12:47080616-47080638 CTGTTGCCGCCTCCTGAGTCAGG - Intronic
1112456328 13:99566800-99566822 CTGACGGCCCCACCGGAGACGGG - Intergenic
1119646029 14:76349174-76349196 CTGGCGGGGCAGCTGGAGTCCGG + Intronic
1121422487 14:93825166-93825188 CGGGCGGCGCCAGCTGAGTCAGG - Intergenic
1121751735 14:96363370-96363392 CCGGCGGCGCGCCGGGAGTCTGG - Exonic
1122736944 14:103848359-103848381 GGGGCGGCGCCTCTGGAGACGGG - Intergenic
1124004630 15:25785946-25785968 CTGGAGACACCTCCGGAGACCGG - Intronic
1128838703 15:70832214-70832236 TTGGCGACGCCTCCGGACCCAGG + Exonic
1129190789 15:73936455-73936477 CTAGGGGCTCCTCTGGAGTCTGG + Intronic
1129463944 15:75713296-75713318 CGGGTGGTGCCTCTGGAGTCTGG - Intergenic
1129719095 15:77868142-77868164 CTTGCAGCGCCTCGGGATTCGGG - Intergenic
1131827058 15:96330526-96330548 ATGGCGGGGCCGCCGCAGTCCGG + Intronic
1133021588 16:2969303-2969325 CTGGCGTCCCCTCCCGCGTCCGG + Exonic
1142205851 16:88782823-88782845 CTGGCCGGGACTCCTGAGTCAGG - Intronic
1160152542 18:76406118-76406140 CGGGCGGTGCCTCCGGAGGAGGG - Intronic
1160784460 19:892981-893003 GTGGCGGGGCCTGCGGGGTCGGG - Intronic
1160883113 19:1331546-1331568 CACGCTGGGCCTCCGGAGTCTGG + Intergenic
1161967363 19:7555838-7555860 ATGGGGGAGCCTCCGGGGTCAGG + Intronic
1162591952 19:11597718-11597740 CCTGCGGCGACTCCGGGGTCTGG + Intronic
1162621712 19:11849000-11849022 CTGTGGGCGACTCCGGGGTCTGG + Intronic
1162630776 19:11925360-11925382 CTGTGGGCGACTCCGGGGTCTGG + Intronic
1162643975 19:12035430-12035452 CCCGCGGCGACTCCGGGGTCTGG - Intronic
1162672099 19:12266174-12266196 CTGCGGGCGACTCCGGGGTCTGG - Intronic
1163630916 19:18417605-18417627 CTGGCGACGGCCCCGGAGCCTGG - Intergenic
1163826165 19:19526067-19526089 CTGGCGGCTTCTCAGGAGTGAGG - Intronic
1164760706 19:30726426-30726448 CTGGCAGGGCCACAGGAGTCAGG + Intergenic
1165448232 19:35868508-35868530 CTGGCGGCGCCGGCGCAGCCCGG + Exonic
1167578370 19:50328448-50328470 TTGGCGGCGCCCGCGGGGTCGGG + Exonic
1168013632 19:53554469-53554491 CGGGAGGCCCCTCCCGAGTCCGG + Intronic
927156831 2:20225397-20225419 CGGGCTGCGCCTCCGCACTCCGG - Exonic
929572427 2:43030970-43030992 CTGGCCCCAGCTCCGGAGTCAGG - Intergenic
931274898 2:60735837-60735859 CGGGCTGCGCCGCCGGAGCCGGG - Intergenic
934846504 2:97664123-97664145 GGGGCGGGGCCTCCGGAGGCTGG + Intergenic
938102048 2:128504116-128504138 CTGGGAGAGCCTCCGGACTCAGG - Intergenic
947592881 2:231395441-231395463 CTGGCGGAGCCTCCCGGGGCGGG - Intergenic
1171210323 20:23311361-23311383 CTGGAGGAGCCTCTGGAGACAGG - Intergenic
1174743227 20:53037143-53037165 CAGGCGCCGCCTCCGAGGTCGGG + Intronic
1176038073 20:63049987-63050009 CTGGCGGCCCTTCTGGAGCCTGG + Intergenic
1180011776 21:45055904-45055926 CTGGCTGCGCCTGCGGAGCGTGG - Intergenic
1185258566 22:49849468-49849490 GTCGCGGCGCCTCCGGGGTGGGG + Intergenic
953526130 3:43691264-43691286 CTCCCGGCGCGGCCGGAGTCCGG - Intronic
953980999 3:47412942-47412964 CTGGCGGCTCCTCCTTAGGCTGG - Exonic
963133158 3:141876709-141876731 CGGGCTGCGCCGCCGGAGCCGGG + Exonic
964622613 3:158732294-158732316 GTGGCGGCGCCCGCGGGGTCCGG - Exonic
968628851 4:1639988-1640010 CTGGCTGCGCCTCAGGCCTCTGG - Exonic
982396975 4:154923816-154923838 CTGGCGGCGGTCACGGAGTCGGG - Intergenic
1001070307 5:168579563-168579585 GTGGCGGCGGCTCCGGGGACCGG - Exonic
1002508846 5:179699298-179699320 CAGGCCGCGCCGCCGGGGTCGGG + Intronic
1006366832 6:33621151-33621173 CTGGCGGCGCATTCGGCGTCCGG + Exonic
1006516031 6:34546204-34546226 CTGGGGGAGACTCCGCAGTCTGG + Intronic
1007098415 6:39228556-39228578 CTGGAGACGCTCCCGGAGTCTGG - Intronic
1011983962 6:93419140-93419162 CCGGCCGCGCCTCCGGCGCCGGG - Intronic
1016658004 6:146543540-146543562 CGGGCGGCGCCTCCGAAGCCCGG - Intergenic
1017842265 6:158231974-158231996 CAGGCGGCGGCTCCGGTGGCGGG + Intergenic
1018044362 6:159952690-159952712 CTGGGGGCGGCTTTGGAGTCTGG + Intergenic
1019220943 6:170472347-170472369 CTGGTGGCACCTCAGGAGACCGG - Intergenic
1019606224 7:1911615-1911637 CTGGAGGTGACGCCGGAGTCTGG - Intronic
1020763158 7:12291861-12291883 CTGGAGGCACCTCCGGGGTTTGG - Intergenic
1028641459 7:93046406-93046428 CTGATGCCGCCTCTGGAGTCTGG + Intergenic
1034781639 7:153887219-153887241 CTGGAGGAGCCCCCGGAGCCGGG + Intronic
1035354581 7:158269337-158269359 ATGGCCGCGCCTCCTGAGGCTGG - Intronic
1035575794 8:703901-703923 CTGTCGTGGCCTCCGTAGTCTGG - Intronic
1043296207 8:78666282-78666304 CCCGCCGCGCCTCCGGAGGCTGG + Intronic
1056126048 9:83537610-83537632 CTGAGGGCGTCTCCGGAGCCTGG + Intronic
1056485440 9:87052451-87052473 GTGGAGCCGCCTCAGGAGTCAGG - Intergenic
1062169349 9:135126353-135126375 CTGGCAGCGTCTCTGGAGTTAGG - Intergenic
1062364386 9:136202041-136202063 CTGGCGGGGGCTCCTGTGTCAGG + Intronic
1062369542 9:136230775-136230797 CTGGCGGATCCTCTGGAGGCCGG - Intronic
1062696573 9:137878839-137878861 GAGGCGGGGCCTCCGCAGTCTGG - Intronic
1195778797 X:108438198-108438220 CTTGCGGCTCCTCCGGAGCTGGG + Intronic
1200000378 X:153056828-153056850 CGGGCGGCGCCTCTGCAGCCAGG - Intronic
1200003311 X:153072814-153072836 CTGGCCGCGCCTCTGCAGCCAGG - Intronic
1200004412 X:153077195-153077217 CTGGCCGCGCCTCTGCAGCCAGG + Intergenic