ID: 905308987

View in Genome Browser
Species Human (GRCh38)
Location 1:37036707-37036729
Sequence AGCCACACTCTCACCCTCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905308987_905308990 0 Left 905308987 1:37036707-37036729 CCCCAGAGGGTGAGAGTGTGGCT No data
Right 905308990 1:37036730-37036752 CTGCCACCTGCGAGCCCCCTCGG No data
905308987_905309004 27 Left 905308987 1:37036707-37036729 CCCCAGAGGGTGAGAGTGTGGCT No data
Right 905309004 1:37036757-37036779 CCAGGGAAGCAGCACAGGCTGGG No data
905308987_905308993 9 Left 905308987 1:37036707-37036729 CCCCAGAGGGTGAGAGTGTGGCT No data
Right 905308993 1:37036739-37036761 GCGAGCCCCCTCGGCGCCCCAGG No data
905308987_905308999 22 Left 905308987 1:37036707-37036729 CCCCAGAGGGTGAGAGTGTGGCT No data
Right 905308999 1:37036752-37036774 GCGCCCCAGGGAAGCAGCACAGG No data
905308987_905309002 26 Left 905308987 1:37036707-37036729 CCCCAGAGGGTGAGAGTGTGGCT No data
Right 905309002 1:37036756-37036778 CCCAGGGAAGCAGCACAGGCTGG No data
905308987_905308994 10 Left 905308987 1:37036707-37036729 CCCCAGAGGGTGAGAGTGTGGCT No data
Right 905308994 1:37036740-37036762 CGAGCCCCCTCGGCGCCCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905308987 Original CRISPR AGCCACACTCTCACCCTCTG GGG (reversed) Intergenic