ID: 905308988

View in Genome Browser
Species Human (GRCh38)
Location 1:37036708-37036730
Sequence GAGCCACACTCTCACCCTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905308988_905308994 9 Left 905308988 1:37036708-37036730 CCCAGAGGGTGAGAGTGTGGCTC No data
Right 905308994 1:37036740-37036762 CGAGCCCCCTCGGCGCCCCAGGG No data
905308988_905309004 26 Left 905308988 1:37036708-37036730 CCCAGAGGGTGAGAGTGTGGCTC No data
Right 905309004 1:37036757-37036779 CCAGGGAAGCAGCACAGGCTGGG No data
905308988_905309002 25 Left 905308988 1:37036708-37036730 CCCAGAGGGTGAGAGTGTGGCTC No data
Right 905309002 1:37036756-37036778 CCCAGGGAAGCAGCACAGGCTGG No data
905308988_905308999 21 Left 905308988 1:37036708-37036730 CCCAGAGGGTGAGAGTGTGGCTC No data
Right 905308999 1:37036752-37036774 GCGCCCCAGGGAAGCAGCACAGG No data
905308988_905308990 -1 Left 905308988 1:37036708-37036730 CCCAGAGGGTGAGAGTGTGGCTC No data
Right 905308990 1:37036730-37036752 CTGCCACCTGCGAGCCCCCTCGG No data
905308988_905308993 8 Left 905308988 1:37036708-37036730 CCCAGAGGGTGAGAGTGTGGCTC No data
Right 905308993 1:37036739-37036761 GCGAGCCCCCTCGGCGCCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905308988 Original CRISPR GAGCCACACTCTCACCCTCT GGG (reversed) Intergenic
No off target data available for this crispr