ID: 905308990

View in Genome Browser
Species Human (GRCh38)
Location 1:37036730-37036752
Sequence CTGCCACCTGCGAGCCCCCT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905308988_905308990 -1 Left 905308988 1:37036708-37036730 CCCAGAGGGTGAGAGTGTGGCTC No data
Right 905308990 1:37036730-37036752 CTGCCACCTGCGAGCCCCCTCGG No data
905308989_905308990 -2 Left 905308989 1:37036709-37036731 CCAGAGGGTGAGAGTGTGGCTCT No data
Right 905308990 1:37036730-37036752 CTGCCACCTGCGAGCCCCCTCGG No data
905308986_905308990 1 Left 905308986 1:37036706-37036728 CCCCCAGAGGGTGAGAGTGTGGC No data
Right 905308990 1:37036730-37036752 CTGCCACCTGCGAGCCCCCTCGG No data
905308987_905308990 0 Left 905308987 1:37036707-37036729 CCCCAGAGGGTGAGAGTGTGGCT No data
Right 905308990 1:37036730-37036752 CTGCCACCTGCGAGCCCCCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905308990 Original CRISPR CTGCCACCTGCGAGCCCCCT CGG Intergenic
No off target data available for this crispr