ID: 905308991

View in Genome Browser
Species Human (GRCh38)
Location 1:37036733-37036755
Sequence GCGCCGAGGGGGCTCGCAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905308991_905309002 0 Left 905308991 1:37036733-37036755 CCACCTGCGAGCCCCCTCGGCGC No data
Right 905309002 1:37036756-37036778 CCCAGGGAAGCAGCACAGGCTGG No data
905308991_905309006 27 Left 905308991 1:37036733-37036755 CCACCTGCGAGCCCCCTCGGCGC No data
Right 905309006 1:37036783-37036805 GCTCCTCCTGCATCCCAGAGTGG No data
905308991_905309004 1 Left 905308991 1:37036733-37036755 CCACCTGCGAGCCCCCTCGGCGC No data
Right 905309004 1:37036757-37036779 CCAGGGAAGCAGCACAGGCTGGG No data
905308991_905309007 28 Left 905308991 1:37036733-37036755 CCACCTGCGAGCCCCCTCGGCGC No data
Right 905309007 1:37036784-37036806 CTCCTCCTGCATCCCAGAGTGGG No data
905308991_905308999 -4 Left 905308991 1:37036733-37036755 CCACCTGCGAGCCCCCTCGGCGC No data
Right 905308999 1:37036752-37036774 GCGCCCCAGGGAAGCAGCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905308991 Original CRISPR GCGCCGAGGGGGCTCGCAGG TGG (reversed) Intergenic
No off target data available for this crispr