ID: 905308993

View in Genome Browser
Species Human (GRCh38)
Location 1:37036739-37036761
Sequence GCGAGCCCCCTCGGCGCCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905308986_905308993 10 Left 905308986 1:37036706-37036728 CCCCCAGAGGGTGAGAGTGTGGC No data
Right 905308993 1:37036739-37036761 GCGAGCCCCCTCGGCGCCCCAGG No data
905308989_905308993 7 Left 905308989 1:37036709-37036731 CCAGAGGGTGAGAGTGTGGCTCT No data
Right 905308993 1:37036739-37036761 GCGAGCCCCCTCGGCGCCCCAGG No data
905308988_905308993 8 Left 905308988 1:37036708-37036730 CCCAGAGGGTGAGAGTGTGGCTC No data
Right 905308993 1:37036739-37036761 GCGAGCCCCCTCGGCGCCCCAGG No data
905308987_905308993 9 Left 905308987 1:37036707-37036729 CCCCAGAGGGTGAGAGTGTGGCT No data
Right 905308993 1:37036739-37036761 GCGAGCCCCCTCGGCGCCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905308993 Original CRISPR GCGAGCCCCCTCGGCGCCCC AGG Intergenic
No off target data available for this crispr