ID: 905308994

View in Genome Browser
Species Human (GRCh38)
Location 1:37036740-37036762
Sequence CGAGCCCCCTCGGCGCCCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905308989_905308994 8 Left 905308989 1:37036709-37036731 CCAGAGGGTGAGAGTGTGGCTCT No data
Right 905308994 1:37036740-37036762 CGAGCCCCCTCGGCGCCCCAGGG No data
905308988_905308994 9 Left 905308988 1:37036708-37036730 CCCAGAGGGTGAGAGTGTGGCTC No data
Right 905308994 1:37036740-37036762 CGAGCCCCCTCGGCGCCCCAGGG No data
905308986_905308994 11 Left 905308986 1:37036706-37036728 CCCCCAGAGGGTGAGAGTGTGGC No data
Right 905308994 1:37036740-37036762 CGAGCCCCCTCGGCGCCCCAGGG No data
905308987_905308994 10 Left 905308987 1:37036707-37036729 CCCCAGAGGGTGAGAGTGTGGCT No data
Right 905308994 1:37036740-37036762 CGAGCCCCCTCGGCGCCCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905308994 Original CRISPR CGAGCCCCCTCGGCGCCCCA GGG Intergenic
No off target data available for this crispr