ID: 905308995

View in Genome Browser
Species Human (GRCh38)
Location 1:37036744-37036766
Sequence GCTTCCCTGGGGCGCCGAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905308995_905309009 20 Left 905308995 1:37036744-37036766 CCCCCTCGGCGCCCCAGGGAAGC No data
Right 905309009 1:37036787-37036809 CTCCTGCATCCCAGAGTGGGCGG No data
905308995_905309004 -10 Left 905308995 1:37036744-37036766 CCCCCTCGGCGCCCCAGGGAAGC No data
Right 905309004 1:37036757-37036779 CCAGGGAAGCAGCACAGGCTGGG No data
905308995_905309010 21 Left 905308995 1:37036744-37036766 CCCCCTCGGCGCCCCAGGGAAGC No data
Right 905309010 1:37036788-37036810 TCCTGCATCCCAGAGTGGGCGGG No data
905308995_905309006 16 Left 905308995 1:37036744-37036766 CCCCCTCGGCGCCCCAGGGAAGC No data
Right 905309006 1:37036783-37036805 GCTCCTCCTGCATCCCAGAGTGG No data
905308995_905309007 17 Left 905308995 1:37036744-37036766 CCCCCTCGGCGCCCCAGGGAAGC No data
Right 905309007 1:37036784-37036806 CTCCTCCTGCATCCCAGAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905308995 Original CRISPR GCTTCCCTGGGGCGCCGAGG GGG (reversed) Intergenic
No off target data available for this crispr