ID: 905308996

View in Genome Browser
Species Human (GRCh38)
Location 1:37036745-37036767
Sequence TGCTTCCCTGGGGCGCCGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905308996_905309010 20 Left 905308996 1:37036745-37036767 CCCCTCGGCGCCCCAGGGAAGCA No data
Right 905309010 1:37036788-37036810 TCCTGCATCCCAGAGTGGGCGGG No data
905308996_905309007 16 Left 905308996 1:37036745-37036767 CCCCTCGGCGCCCCAGGGAAGCA No data
Right 905309007 1:37036784-37036806 CTCCTCCTGCATCCCAGAGTGGG No data
905308996_905309009 19 Left 905308996 1:37036745-37036767 CCCCTCGGCGCCCCAGGGAAGCA No data
Right 905309009 1:37036787-37036809 CTCCTGCATCCCAGAGTGGGCGG No data
905308996_905309006 15 Left 905308996 1:37036745-37036767 CCCCTCGGCGCCCCAGGGAAGCA No data
Right 905309006 1:37036783-37036805 GCTCCTCCTGCATCCCAGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905308996 Original CRISPR TGCTTCCCTGGGGCGCCGAG GGG (reversed) Intergenic
No off target data available for this crispr