ID: 905308998

View in Genome Browser
Species Human (GRCh38)
Location 1:37036747-37036769
Sequence GCTGCTTCCCTGGGGCGCCG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905308998_905309006 13 Left 905308998 1:37036747-37036769 CCTCGGCGCCCCAGGGAAGCAGC No data
Right 905309006 1:37036783-37036805 GCTCCTCCTGCATCCCAGAGTGG No data
905308998_905309007 14 Left 905308998 1:37036747-37036769 CCTCGGCGCCCCAGGGAAGCAGC No data
Right 905309007 1:37036784-37036806 CTCCTCCTGCATCCCAGAGTGGG No data
905308998_905309009 17 Left 905308998 1:37036747-37036769 CCTCGGCGCCCCAGGGAAGCAGC No data
Right 905309009 1:37036787-37036809 CTCCTGCATCCCAGAGTGGGCGG No data
905308998_905309010 18 Left 905308998 1:37036747-37036769 CCTCGGCGCCCCAGGGAAGCAGC No data
Right 905309010 1:37036788-37036810 TCCTGCATCCCAGAGTGGGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905308998 Original CRISPR GCTGCTTCCCTGGGGCGCCG AGG (reversed) Intergenic
No off target data available for this crispr