ID: 905308999

View in Genome Browser
Species Human (GRCh38)
Location 1:37036752-37036774
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905308988_905308999 21 Left 905308988 1:37036708-37036730 CCCAGAGGGTGAGAGTGTGGCTC No data
Right 905308999 1:37036752-37036774 GCGCCCCAGGGAAGCAGCACAGG No data
905308987_905308999 22 Left 905308987 1:37036707-37036729 CCCCAGAGGGTGAGAGTGTGGCT No data
Right 905308999 1:37036752-37036774 GCGCCCCAGGGAAGCAGCACAGG No data
905308989_905308999 20 Left 905308989 1:37036709-37036731 CCAGAGGGTGAGAGTGTGGCTCT No data
Right 905308999 1:37036752-37036774 GCGCCCCAGGGAAGCAGCACAGG No data
905308991_905308999 -4 Left 905308991 1:37036733-37036755 CCACCTGCGAGCCCCCTCGGCGC No data
Right 905308999 1:37036752-37036774 GCGCCCCAGGGAAGCAGCACAGG No data
905308986_905308999 23 Left 905308986 1:37036706-37036728 CCCCCAGAGGGTGAGAGTGTGGC No data
Right 905308999 1:37036752-37036774 GCGCCCCAGGGAAGCAGCACAGG No data
905308992_905308999 -7 Left 905308992 1:37036736-37036758 CCTGCGAGCCCCCTCGGCGCCCC No data
Right 905308999 1:37036752-37036774 GCGCCCCAGGGAAGCAGCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type